ID: 1179650809

View in Genome Browser
Species Human (GRCh38)
Location 21:42807359-42807381
Sequence CTGAATATACAAATGAACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179650809_1179650814 26 Left 1179650809 21:42807359-42807381 CCATTGTTCATTTGTATATTCAG No data
Right 1179650814 21:42807408-42807430 CCTCATGGTCCTAATGTAGCAGG No data
1179650809_1179650810 0 Left 1179650809 21:42807359-42807381 CCATTGTTCATTTGTATATTCAG No data
Right 1179650810 21:42807382-42807404 TTTCTCAATATTTGCCATCAAGG No data
1179650809_1179650811 11 Left 1179650809 21:42807359-42807381 CCATTGTTCATTTGTATATTCAG No data
Right 1179650811 21:42807393-42807415 TTGCCATCAAGGTGACCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179650809 Original CRISPR CTGAATATACAAATGAACAA TGG (reversed) Intergenic
No off target data available for this crispr