ID: 1179654677

View in Genome Browser
Species Human (GRCh38)
Location 21:42837787-42837809
Sequence CAGGGTTGGCAGAGGGCGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179654677_1179654697 21 Left 1179654677 21:42837787-42837809 CCCTCCGCCCTCTGCCAACCCTG No data
Right 1179654697 21:42837831-42837853 TTGTCCTCTGCTGCTGGCCTTGG No data
1179654677_1179654698 22 Left 1179654677 21:42837787-42837809 CCCTCCGCCCTCTGCCAACCCTG No data
Right 1179654698 21:42837832-42837854 TGTCCTCTGCTGCTGGCCTTGGG No data
1179654677_1179654695 15 Left 1179654677 21:42837787-42837809 CCCTCCGCCCTCTGCCAACCCTG No data
Right 1179654695 21:42837825-42837847 CCGTCCTTGTCCTCTGCTGCTGG No data
1179654677_1179654699 23 Left 1179654677 21:42837787-42837809 CCCTCCGCCCTCTGCCAACCCTG No data
Right 1179654699 21:42837833-42837855 GTCCTCTGCTGCTGGCCTTGGGG No data
1179654677_1179654683 -10 Left 1179654677 21:42837787-42837809 CCCTCCGCCCTCTGCCAACCCTG No data
Right 1179654683 21:42837800-42837822 GCCAACCCTGGCCCCTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179654677 Original CRISPR CAGGGTTGGCAGAGGGCGGA GGG (reversed) Intergenic
No off target data available for this crispr