ID: 1179654805

View in Genome Browser
Species Human (GRCh38)
Location 21:42838235-42838257
Sequence GGCTGTGGAAGGAGGCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179654805_1179654817 26 Left 1179654805 21:42838235-42838257 CCTTCTGGCCTCCTTCCACAGCC No data
Right 1179654817 21:42838284-42838306 AGGTGCTGTCATTGTTTAGCTGG No data
1179654805_1179654811 6 Left 1179654805 21:42838235-42838257 CCTTCTGGCCTCCTTCCACAGCC No data
Right 1179654811 21:42838264-42838286 ACATCTCACCCACTTCCCCGAGG No data
1179654805_1179654818 27 Left 1179654805 21:42838235-42838257 CCTTCTGGCCTCCTTCCACAGCC No data
Right 1179654818 21:42838285-42838307 GGTGCTGTCATTGTTTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179654805 Original CRISPR GGCTGTGGAAGGAGGCCAGA AGG (reversed) Intergenic
No off target data available for this crispr