ID: 1179658321

View in Genome Browser
Species Human (GRCh38)
Location 21:42859484-42859506
Sequence AGTCCTGAGTGAGCGGCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 76}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179658315_1179658321 18 Left 1179658315 21:42859443-42859465 CCACAGGCGAACACACACGCACC 0: 1
1: 1
2: 0
3: 13
4: 248
Right 1179658321 21:42859484-42859506 AGTCCTGAGTGAGCGGCCGCAGG 0: 1
1: 0
2: 0
3: 11
4: 76
1179658316_1179658321 -3 Left 1179658316 21:42859464-42859486 CCTACGCACACCCCACACGCAGT 0: 1
1: 0
2: 0
3: 23
4: 189
Right 1179658321 21:42859484-42859506 AGTCCTGAGTGAGCGGCCGCAGG 0: 1
1: 0
2: 0
3: 11
4: 76
1179658314_1179658321 19 Left 1179658314 21:42859442-42859464 CCCACAGGCGAACACACACGCAC 0: 1
1: 0
2: 2
3: 46
4: 510
Right 1179658321 21:42859484-42859506 AGTCCTGAGTGAGCGGCCGCAGG 0: 1
1: 0
2: 0
3: 11
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179658321 Original CRISPR AGTCCTGAGTGAGCGGCCGC AGG Intronic
901479944 1:9518349-9518371 AGTCCTGAATGAGGAGCAGCTGG - Intergenic
902562954 1:17289414-17289436 AGTCCTGGGGGAGTGGCCACTGG - Intergenic
904296376 1:29522120-29522142 GGTCCTGAGTGGGCGGGCGGGGG - Intergenic
904367658 1:30025033-30025055 AGCCCTGAGTGAGCTGTCCCAGG - Intergenic
905915687 1:41682750-41682772 AGCCCTGAGTGAGCTTCCGCAGG - Intronic
906129685 1:43448593-43448615 AGTCCTGAGGGAGGAGCCACAGG - Exonic
916033023 1:160894936-160894958 ATGCCTGGGGGAGCGGCCGCGGG - Intergenic
922502092 1:226104754-226104776 AGTCCTGAGTGGGAGGGAGCTGG - Intergenic
924783804 1:247175859-247175881 AGAGCTGAGTGAGCAGCCACTGG - Intergenic
1067878610 10:50025073-50025095 AGGCCTCAGTGAGCGGCCCATGG + Intergenic
1069797399 10:71062140-71062162 AGGCCTGAGTGAGATGCAGCTGG - Intergenic
1072753191 10:97999166-97999188 AGTCCTGGGTCAGCAGCCCCAGG - Intronic
1073102795 10:101015695-101015717 GGTCCTGAATGAGGGGCCGCCGG + Intronic
1073666399 10:105539086-105539108 ACTCCTGAGGGAGCCACCGCTGG + Intergenic
1077358936 11:2131215-2131237 CGGCCTGAGTGTGCGGCCGGCGG - Intronic
1079437720 11:20474517-20474539 AGTCCTGGCAGAGCAGCCGCTGG - Intronic
1080637459 11:34136555-34136577 AGTCCAGAGTGCGCTGCGGCAGG + Intronic
1080793983 11:35546448-35546470 AGTACCGAGTGAGCAGCCCCAGG - Intergenic
1092185960 12:6478534-6478556 TGTTCTGAGTGAGGGGCCGCAGG - Intergenic
1096494663 12:52033121-52033143 AGTCCGGAGGGAGCCGCAGCAGG - Intronic
1097513728 12:60576409-60576431 ATTCCTGAGTGAGTGTCCCCTGG - Intergenic
1103909928 12:124346575-124346597 AGCCCTCCTTGAGCGGCCGCGGG + Exonic
1105069807 12:133227578-133227600 GGTGCTGAGTGAGCAGCCGTGGG + Intronic
1105417691 13:20227526-20227548 GGTCCTGAGTGGGCTGCCCCTGG + Intronic
1106248413 13:27967076-27967098 TGTCCCGGGAGAGCGGCCGCGGG - Intronic
1121461332 14:94080995-94081017 GGTCCAGAGAGGGCGGCCGCCGG - Intronic
1122418274 14:101560649-101560671 GTTCCTGGGTCAGCGGCCGCCGG - Intergenic
1122790215 14:104181223-104181245 AGCCCTGTGTAAGCGGCCCCTGG + Intergenic
1122978574 14:105181137-105181159 AATGCAGCGTGAGCGGCCGCAGG + Exonic
1123060371 14:105591698-105591720 AGTGCTGAGTGGGCGGCCTCCGG + Intergenic
1123084849 14:105712669-105712691 AGTGCTGAGTGGGCGGCCTCCGG + Intergenic
1123964014 15:25438265-25438287 AGTCCTGGCTGAGCGACGGCGGG - Intronic
1125857529 15:42964633-42964655 GGTCCTGTGTGAGCTGCCCCTGG + Intronic
1128880733 15:71240245-71240267 AGTGCTGAGTGAGCTCCAGCAGG + Intronic
1130905992 15:88241310-88241332 AGTCCTGAGTGAGTGACAGAAGG + Intronic
1134134094 16:11668449-11668471 CGTCCCGAGTGCGCGGCGGCCGG + Exonic
1139908325 16:70381395-70381417 AGTGGGGATTGAGCGGCCGCTGG + Exonic
1141657740 16:85425063-85425085 AGTCCTGGGTGAGTGGCCCGGGG - Intergenic
1142028489 16:87826947-87826969 GGCCCCGAGTGAGCGGCGGCCGG - Intergenic
1142425842 16:90001860-90001882 TGTCCTGGGTGAGCGGCCGGAGG + Intergenic
1142757453 17:2024578-2024600 AGACCAGAGTGAGCGGCCGGTGG - Intronic
1143014059 17:3882486-3882508 AGCCCTGAGTGAGCTGCTGTGGG + Intronic
1145241926 17:21245204-21245226 AGGCCTGAATGAGGGGCCGCTGG + Intronic
1153690873 18:7592456-7592478 AGTCCTGAGAGAGTGGCAGAGGG - Intronic
1157494368 18:48144703-48144725 AGTCCTGAGTGAGAGGTCAGGGG - Intronic
1160071879 18:75636174-75636196 AGTGCTGAGTGAGGGTCCCCTGG + Intergenic
1160510630 18:79451622-79451644 TGTCCTGAGTGGGCGGCCTGGGG - Intronic
1162124097 19:8490131-8490153 GCTCCTGGGTGAGCGGGCGCTGG + Exonic
1162817901 19:13207472-13207494 AGTCCTGGGCGAGCGCCCGGTGG + Exonic
926151245 2:10426814-10426836 AGTTCTGAGCGAGCGGCCCCTGG + Exonic
927142522 2:20140012-20140034 AGCCCAGAGTGAAGGGCCGCGGG + Intergenic
927943162 2:27118536-27118558 AGTCCTGGGGGAGGGGCAGCTGG - Intronic
935268344 2:101413421-101413443 GATCCTGAGGGAGCGGCTGCGGG + Intronic
945053423 2:205847486-205847508 AGTCCTGAGTGACTGGCAGGTGG - Intergenic
1179658321 21:42859484-42859506 AGTCCTGAGTGAGCGGCCGCAGG + Intronic
1183619065 22:38962180-38962202 AGCCCTGAGTGGGAGGCTGCGGG + Exonic
1183624268 22:38992116-38992138 AGCCCTGAGTGGGAGGCTGCGGG + Exonic
1183640023 22:39087093-39087115 AGACCTGAGTGGGAGGCTGCGGG + Exonic
1183649287 22:39145073-39145095 AGTCCTCAGTGTCCGACCGCAGG + Intronic
949415981 3:3814444-3814466 AACCCTGAGTGAGCTACCGCAGG - Intronic
953576984 3:44120762-44120784 AGGCCTGTGTGAGCAGCAGCAGG - Intergenic
954108303 3:48420746-48420768 AGGCCTGTGTGAGCAGCCGCTGG - Exonic
954625410 3:52019632-52019654 AGTCCTGTGTGAGGGGCAGAGGG + Intergenic
967837130 3:193974319-193974341 AGTCCTCAGTGTGGGGGCGCTGG - Intergenic
967991739 3:195136513-195136535 AGTCCTGACCAAGCGGCCCCGGG + Intronic
975629206 4:76382250-76382272 AGTCGTGAGTGGGAGGCCTCAGG - Intronic
979041582 4:115804565-115804587 AATCATAAGTGAGCGGCAGCAGG - Intergenic
980861833 4:138508384-138508406 TGTTCTGAGTGAGCTGCTGCAGG + Intergenic
984620060 4:181942457-181942479 AGTCCTGAGTGAGGGACCAGTGG + Intergenic
994406650 5:99353104-99353126 AGTCATGACTGAGCAGCTGCAGG + Intergenic
997402102 5:133611628-133611650 GGTCCAGAGTGAGCGGCCCGGGG - Intronic
998386320 5:141759017-141759039 AGTCCTGTCTGAGGGGCTGCAGG - Intergenic
999804278 5:155067412-155067434 GGTCCTGAGGGAGTGGGCGCGGG + Intergenic
1004031578 6:11875301-11875323 AATCATGAGTGAGTGGCCACAGG - Intergenic
1004839668 6:19568851-19568873 AGTCCTGGGAGAGAGGCCTCTGG + Intergenic
1005485703 6:26297217-26297239 AGGCCTGAGTGAGATGCAGCTGG + Intergenic
1007311265 6:40947832-40947854 AGTCCTGAGGGAGCGGGAGCTGG - Intergenic
1012846583 6:104397102-104397124 AGTCCTGAGAGAGCAGCTTCTGG - Intergenic
1019474437 7:1237010-1237032 GAGCCTGAGCGAGCGGCCGCGGG - Exonic
1020091794 7:5345917-5345939 AGTCCTGAGCAGGGGGCCGCTGG + Intronic
1029679189 7:102096261-102096283 AGTCAGGGGTTAGCGGCCGCAGG - Intronic
1029917269 7:104224063-104224085 AGTTCTGAGTGAGCTGCATCTGG + Intergenic
1037834886 8:22209929-22209951 AGGCCTGGGTCAGAGGCCGCAGG - Intronic
1061431735 9:130535647-130535669 AGCCCTGAGTGAGCAGCTGGAGG + Intergenic
1061816490 9:133200333-133200355 AGAGCTGAGTGAGAGCCCGCGGG + Intergenic
1062186207 9:135219995-135220017 AGGCCTGGGTGAGGGGCAGCTGG - Intergenic
1062481529 9:136754740-136754762 AGCCCTGAGGCAGCGCCCGCAGG + Intronic
1203769540 EBV:41877-41899 ACACCTGAGGGAGCGGCCGTTGG + Intergenic