ID: 1179659465

View in Genome Browser
Species Human (GRCh38)
Location 21:42865201-42865223
Sequence GGGTAAACACAGAGAAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 536
Summary {0: 1, 1: 0, 2: 1, 3: 51, 4: 483}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179659456_1179659465 30 Left 1179659456 21:42865148-42865170 CCTCACAGCTGTGCAGCAGAGCT 0: 1
1: 0
2: 2
3: 26
4: 287
Right 1179659465 21:42865201-42865223 GGGTAAACACAGAGAAAACAAGG 0: 1
1: 0
2: 1
3: 51
4: 483

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179659465 Original CRISPR GGGTAAACACAGAGAAAACA AGG Intronic
900857734 1:5199487-5199509 GTGTGAACACAGAGAAAAGGAGG + Intergenic
901177203 1:7312990-7313012 GTATAAACACACAGAAAAAAAGG - Intronic
903766768 1:25740144-25740166 GGGGAAAACCAGAGAAGACAAGG + Intronic
903999108 1:27328253-27328275 GGGCAGATACAGAGAAAGCATGG + Intronic
904405819 1:30287303-30287325 GGGGAAACACTGGGAAACCAAGG + Intergenic
905686157 1:39910088-39910110 GGGAGAAGTCAGAGAAAACAGGG - Intergenic
906301718 1:44687206-44687228 GTGAAGACACAGGGAAAACATGG - Intronic
908128965 1:61055523-61055545 ATGTAAACACAGGGAAAGCAAGG - Intronic
908736711 1:67284113-67284135 AGGTAAACAATGAGAACACATGG - Intergenic
908781650 1:67696251-67696273 GGATAAACCCAGAAAACACAAGG - Intergenic
909444072 1:75728727-75728749 GGCTAAACACTCAGAAAAAAAGG - Intronic
910614713 1:89184638-89184660 GGCCAAACAAAGAGAACACATGG + Exonic
910780130 1:90922788-90922810 GGCTAAACAACGAGAACACATGG - Intronic
911075430 1:93868792-93868814 AGGTAAACAATGAGAACACATGG + Exonic
911239613 1:95450752-95450774 GGGTAAAGAAAAAGAAGACATGG + Intergenic
911712973 1:101096180-101096202 CCGTAAAAACAGAGAAATCATGG - Intergenic
911732467 1:101305404-101305426 GGATAAAGAAAGAGAAATCAGGG - Intergenic
911850754 1:102816796-102816818 GAGTACACAGAGAGATAACAGGG + Intergenic
913417435 1:118626373-118626395 GGTTAAAGACAGAAAAAAAATGG - Intergenic
914916303 1:151821331-151821353 GGGTTCACACAGAGAAACCCCGG + Intronic
915847654 1:159284537-159284559 TTGTAATCAGAGAGAAAACAGGG - Intergenic
916052246 1:161044685-161044707 GGGTAAAAAAAAAAAAAACAGGG + Intronic
916970549 1:170009058-170009080 AGGTGAACACTGAGAACACATGG + Intronic
917472226 1:175335497-175335519 GGGAAGAGACAGAGAAAAGAGGG + Intronic
917818594 1:178737048-178737070 GGGTAACAAAAGATAAAACAAGG - Intronic
918287483 1:183071847-183071869 GGCAAAACACATGGAAAACAAGG + Intronic
919404797 1:197165980-197166002 GGCTGAACAAAGAGAACACATGG + Intronic
919925581 1:202190217-202190239 GGGAGGACACAGAGAAAACCTGG + Intergenic
921891828 1:220361304-220361326 GGGAAGACACAGGGAAAAGACGG + Intergenic
922607273 1:226897454-226897476 GTGTTAAGACTGAGAAAACAAGG + Intergenic
923722050 1:236475337-236475359 GACTTAACACAGAGCAAACAAGG - Intronic
923918738 1:238540368-238540390 GGGAAACAACAGAGCAAACAGGG - Intergenic
924413671 1:243834444-243834466 AGGTAAACACTGAGTACACATGG + Intronic
924463223 1:244277745-244277767 AGCTAAACAATGAGAAAACATGG - Intergenic
1062925611 10:1313601-1313623 GGGGAAACACAACTAAAACAGGG + Intronic
1063601829 10:7489092-7489114 GACTAAAATCAGAGAAAACACGG + Intergenic
1063926553 10:10983433-10983455 GAGTAAACACATATATAACATGG + Intergenic
1066195797 10:33098483-33098505 GGGGAAAGAGAGAGAACACAGGG - Intergenic
1067315053 10:45153288-45153310 AGATAAAAACAGAGACAACAGGG - Intergenic
1067441985 10:46313751-46313773 GGATAAAAACAGTGAAAGCATGG - Intronic
1068322809 10:55441899-55441921 GGGCACACACAGAGAGCACAAGG + Intronic
1068906494 10:62330389-62330411 GGATACACAGAGAGAAATCAGGG + Intergenic
1069676696 10:70253858-70253880 GGGGAAAGCCAGAGTAAACAGGG + Exonic
1070068858 10:73066367-73066389 GACTAAACACAGTGAAATCAGGG + Intronic
1070214361 10:74361395-74361417 TGGTAACCACAGAGCAAAAATGG - Intronic
1070807204 10:79277622-79277644 GGGCAAACCCAGAGAAACCAGGG + Intronic
1070872385 10:79767991-79768013 GGGTAAAGAAAAAGAAATCAAGG + Intergenic
1071468927 10:85965576-85965598 AGTTAAACACTGAGAACACATGG + Intronic
1071544288 10:86516445-86516467 AAGTAAACACAGACAAAACTTGG - Intronic
1071639306 10:87290143-87290165 GGGTAAAGAAAAAGAAATCAAGG + Intergenic
1071655931 10:87447806-87447828 GGGTAAAGAAAAAGAAATCAAGG - Intergenic
1071860819 10:89670781-89670803 GGGCAAACTCTGAGAAACCAAGG - Intergenic
1073030845 10:100524397-100524419 GGGAAAGCACAGAGGAGACAAGG + Intronic
1073047682 10:100650427-100650449 GGGTAAAGACAGAGAGGAGAAGG + Intergenic
1073310276 10:102535184-102535206 GGGGAAAGAAAGAGACAACAGGG + Intronic
1073800103 10:107032388-107032410 AGGTAAGCAAAGAGAAATCAAGG - Intronic
1073946850 10:108760799-108760821 GAGTTAACCCAGAGAAGACAGGG + Intergenic
1073959083 10:108905142-108905164 GAGTAAAAACAGAGAGAAGAGGG + Intergenic
1074287804 10:112115088-112115110 GCATAAACAAAAAGAAAACAGGG - Intergenic
1074326101 10:112452832-112452854 TGTTAATCACAGAGAAAACTGGG - Intronic
1074849809 10:117430599-117430621 GGTTGAACACTGAGAACACATGG - Intergenic
1076330364 10:129659954-129659976 GGGTGATGAAAGAGAAAACACGG - Intronic
1077531152 11:3095747-3095769 GGGTAACCACATAGTAGACAAGG + Intronic
1077642236 11:3892241-3892263 GGAAGAAAACAGAGAAAACATGG + Intronic
1077951779 11:6967011-6967033 AGGTGAACAAAGAGAACACATGG - Intronic
1079346451 11:19656791-19656813 CGGTAGCCACAGAGGAAACAAGG + Intronic
1079449055 11:20583556-20583578 GAAAAGACACAGAGAAAACACGG - Intergenic
1079471766 11:20785324-20785346 GGGTCAGCCCAGAGAAAGCAAGG + Intronic
1079479858 11:20867958-20867980 AGGTAAACACAGAGAAATAGAGG + Intronic
1079984718 11:27188362-27188384 AGGTAAACACAGACAATAAACGG - Intergenic
1085044310 11:73344325-73344347 AGGTAAAGACACAGAAAACAAGG - Intronic
1085212344 11:74792333-74792355 AGGTAATCTTAGAGAAAACAAGG + Intronic
1086330136 11:85745743-85745765 GAGTAAAGACAGAGAAAATGGGG - Exonic
1086649994 11:89276812-89276834 GTGTAAACACACAGAGAACAGGG + Intronic
1088384074 11:109232998-109233020 GAGGAAACACAGAGCAGACAGGG - Intergenic
1088429643 11:109744951-109744973 TGGAAAATACAGAGAGAACATGG - Intergenic
1089979590 11:122761248-122761270 GAGTAAACACAAAGAAGTCACGG - Intronic
1090635685 11:128689389-128689411 GGGTACACAAGGAGAAAAAAAGG - Intronic
1091063451 11:132486692-132486714 GTGTAAAAAAAGAGAAAAAAAGG - Intronic
1092096233 12:5844295-5844317 GGGTAAACCCAGAGAAAGCCCGG + Intronic
1093288156 12:17291587-17291609 GTGGAAACACAGAGTAATCATGG - Intergenic
1093558858 12:20513303-20513325 GAGTAAAACCAGAGAAAATAGGG + Intronic
1094255546 12:28421411-28421433 AGCTAAACACTGAGAATACATGG - Intronic
1094464670 12:30739342-30739364 GGCTAAACAATGAGAACACATGG + Intronic
1095216280 12:39553811-39553833 AGCTAAGCACAGAGAAAAAAAGG - Exonic
1095517341 12:43021161-43021183 GAGAAAAAAGAGAGAAAACAAGG - Intergenic
1095783871 12:46089333-46089355 AGTTAAACACAAAGTAAACAAGG - Intergenic
1097145994 12:56939671-56939693 GGGGTAAGACAGAGAAACCAAGG + Intergenic
1097151713 12:56984151-56984173 GGGCTAAGACAGAGAAACCAAGG + Intergenic
1097894440 12:64810266-64810288 CTGTAAGAACAGAGAAAACATGG - Intronic
1098582914 12:72121964-72121986 GGGTAGAGACAGAGAAAAGGAGG - Intronic
1098689315 12:73466641-73466663 GGGAAAACACAGAGAGAAGATGG + Intergenic
1098800153 12:74946527-74946549 GGGTAAAAACAGAGAAAGACTGG + Intergenic
1098932824 12:76439984-76440006 GAGTAAACCCAAAGTAAACAGGG - Intronic
1099531075 12:83781966-83781988 CTGTCAACACAAAGAAAACAAGG + Intergenic
1099698201 12:86048249-86048271 GGCTAAACACTGAGTACACATGG + Intronic
1101554819 12:105799218-105799240 TGGAAAACACAGAGAAAATGAGG - Intergenic
1101593799 12:106145703-106145725 GGTTTAGAACAGAGAAAACAAGG - Intergenic
1102610031 12:114103945-114103967 GGATAAACTCAAACAAAACAAGG + Intergenic
1102615558 12:114151246-114151268 GGTTAAACAATGAGAACACATGG + Intergenic
1102674859 12:114650505-114650527 GGGTAAAAACAGAGGACCCAAGG + Intergenic
1103167296 12:118781116-118781138 GAGTAAACACAGAGAAATATAGG + Intergenic
1103330394 12:120150090-120150112 GGGTAGCCACAGAGAACAGAAGG + Intronic
1103832399 12:123790162-123790184 AATTTAACACAGAGAAAACATGG - Intronic
1103871323 12:124094454-124094476 TGGGGAACACAGAGAGAACACGG + Intronic
1104252284 12:127106772-127106794 GGGAAAAGACACAGAAAAGAAGG - Intergenic
1104440618 12:128790511-128790533 GGTCAAACAGAGAAAAAACAAGG + Intergenic
1106002459 13:25737128-25737150 GGGACAACACACAGGAAACACGG - Intronic
1106045987 13:26142672-26142694 GGGTACACACAGACATAAGATGG + Intronic
1106157112 13:27169786-27169808 ATGTAAACACCAAGAAAACAGGG + Intronic
1106790608 13:33151959-33151981 CGTTAAACACAGAGGAAACAGGG + Intronic
1107592961 13:41927674-41927696 GGGTAACAACAGAGAAAGAAAGG + Intronic
1108139508 13:47404884-47404906 GTGTAAACACAGAGAGGAAATGG - Intergenic
1108715975 13:53078248-53078270 ACGTAAACACAAAGAACACAAGG + Intergenic
1108757690 13:53523478-53523500 GGGCAAACACTGAAATAACAGGG - Intergenic
1109036477 13:57268238-57268260 AGCTAAACACTGAGCAAACATGG - Intergenic
1109551584 13:63909426-63909448 GAGTAAATATAGAGAAAAGACGG - Intergenic
1110153366 13:72282744-72282766 GGGTAGAGAAAGAGAAACCATGG - Intergenic
1111779253 13:92700729-92700751 GGGTAACCTCAGAGAAAAGCTGG - Intronic
1112200731 13:97271632-97271654 AGTTAAACACTGAGAACACATGG - Intronic
1112243159 13:97702134-97702156 GAGAAAGCACAAAGAAAACAAGG + Intergenic
1112801059 13:103110172-103110194 GGGAAAACACTGAGAGCACAGGG - Intergenic
1113136050 13:107090811-107090833 GGTTGAACAATGAGAAAACATGG + Intergenic
1114602424 14:23967454-23967476 AGGTAAACACAGAGACATCGGGG + Intronic
1114606793 14:24004580-24004602 AGGTAAACACAGAGACATCGGGG + Intronic
1114612095 14:24049528-24049550 AGGTAAACACAGAGACATCGGGG + Intergenic
1114882173 14:26799362-26799384 GAGAAAAGACAGAGAAAAAATGG + Intergenic
1115294833 14:31813736-31813758 AGTTGAACAAAGAGAAAACATGG - Intronic
1115418766 14:33168219-33168241 GGGTAAACTCTGAGAAATCCTGG + Intronic
1115975624 14:38993434-38993456 GGGTAGACACTGAGTACACATGG + Intergenic
1116700324 14:48232833-48232855 GTGGAAACAAAGAGAAAAGAAGG + Intergenic
1116763912 14:49047807-49047829 GGCTAAATATACAGAAAACATGG + Intergenic
1117639433 14:57782506-57782528 GGGTAAACAGAGACCATACATGG + Intronic
1117843481 14:59885662-59885684 GGGTAAACACTGATATAAAAGGG + Intergenic
1118427390 14:65681092-65681114 GTTTAAATACAGTGAAAACATGG - Intronic
1119350485 14:73960748-73960770 GGGGAAACACAGAGAAAGACTGG + Intronic
1120804839 14:88736297-88736319 AGATAAACATAAAGAAAACATGG - Intronic
1121395033 14:93613938-93613960 TGAAACACACAGAGAAAACAAGG - Intronic
1121481107 14:94275302-94275324 GGGTAACCAAAGAGAAGAAAAGG - Intronic
1121493792 14:94378320-94378342 AGGGAGACTCAGAGAAAACATGG + Exonic
1123796162 15:23772905-23772927 GGCTAAACACTGAGTACACATGG - Intergenic
1124106764 15:26745365-26745387 ATGTAAACACTGAGAAAACTGGG - Intronic
1124214277 15:27793698-27793720 GGTTAAGAACAGAGATAACAGGG + Intronic
1124359845 15:29028203-29028225 AGCTGAACACTGAGAAAACATGG - Intronic
1126201102 15:45987211-45987233 GGTTAAACAACGAGAACACATGG + Intergenic
1126667139 15:51085652-51085674 GGGTAAACACAAAGAAGCCATGG + Intronic
1126723455 15:51606854-51606876 GGATAAAAAGATAGAAAACATGG + Intronic
1126835948 15:52665049-52665071 GAGTAAACACTGAGTATACATGG + Intronic
1127056931 15:55141744-55141766 AGGTGAACAAAGAGAACACATGG + Intergenic
1127132008 15:55875929-55875951 GGATAAACATAAAGAAAACATGG + Intronic
1129030268 15:72612529-72612551 GGGCATACACAGAACAAACAGGG - Intergenic
1130114612 15:80996005-80996027 AGGTGAACAGAGAGAAAGCATGG + Intergenic
1130158354 15:81373685-81373707 GAGTGAACATAGAGAAAACAGGG + Intronic
1130331656 15:82926820-82926842 GGGCAAAGAGAGAGAAAAAAGGG - Intronic
1130752710 15:86729479-86729501 AGCTAAACACTGAGTAAACATGG - Intronic
1130888033 15:88110220-88110242 GGGTAAAGAAAGAGACAATAAGG + Intronic
1131618412 15:94041150-94041172 AGCTAAACACTGAGAACACATGG + Intergenic
1132377272 15:101337601-101337623 GGAAAAAGAAAGAGAAAACAGGG - Intronic
1132484814 16:185335-185357 GGGTGAAAAAAGTGAAAACATGG + Intergenic
1133511318 16:6460235-6460257 GGAAAAACACAGGGAAAAGATGG - Intronic
1133566884 16:7004347-7004369 GGGTAAAAGCAAAGACAACATGG + Intronic
1133631230 16:7623804-7623826 AGGTGAAGACAGAGAAAAGATGG - Intronic
1134338731 16:13325839-13325861 GGGTAAACAGTGAGAACACATGG + Intergenic
1134345878 16:13391397-13391419 GGCTAAAGAAAGGGAAAACAAGG + Intergenic
1134565258 16:15246490-15246512 GGGAAGACACAGTGAAAAGAGGG - Intergenic
1134737238 16:16510208-16510230 GGGAAGACACAGTGAAAAGAGGG + Intergenic
1134766495 16:16763322-16763344 GGGAAAACACTGAGAAATGAAGG + Intergenic
1134930280 16:18201952-18201974 GGGAAGACACAGTGAAAAGAGGG - Intergenic
1136608906 16:31354600-31354622 GGGGAAGCACAGAGACCACAGGG - Intergenic
1137549682 16:49428841-49428863 GGGTACACACTGTGAAAAAAAGG - Intergenic
1137722861 16:50638061-50638083 GTCTAAACACTGAGAAAACGGGG - Exonic
1138058087 16:53857287-53857309 AGCTAAACACTGAGTAAACATGG - Intronic
1138457201 16:57128006-57128028 GGGTGAACACAGGGAAGGCAGGG - Intronic
1139069790 16:63366128-63366150 GAGTATGCACAGAGAAGACATGG + Intergenic
1139494379 16:67305650-67305672 GCGTAAAGACAGAAAAAAAAAGG - Intronic
1143859354 17:9876910-9876932 GGGTAAACCCTCAGAAAAAATGG - Intronic
1144184818 17:12787131-12787153 GGTTGAACAAAGAGAAAACATGG - Intergenic
1144366327 17:14548350-14548372 GATTAAACATCGAGAAAACAAGG + Intergenic
1146532162 17:33617438-33617460 GGCTAAACACTGAGAACACATGG + Intronic
1146950336 17:36900964-36900986 GGAGAAACACTGAGAAAAGATGG - Intergenic
1147212543 17:38880286-38880308 GATAAAACGCAGAGAAAACAAGG - Intronic
1147267397 17:39243170-39243192 GAGAAGAAACAGAGAAAACAGGG - Intergenic
1148902889 17:50891808-50891830 GGGTTAACACAAGGAAAGCATGG - Intergenic
1148952361 17:51324711-51324733 GGGTAAACAAATAATAAACAAGG - Intergenic
1149179602 17:53918677-53918699 GGGTGAACAATGAGAACACATGG + Intergenic
1149533552 17:57414920-57414942 GGGTAGACACAGAGAAGGGAAGG + Intronic
1150821920 17:68442080-68442102 GCTTAAACAGAGAGAAAATAAGG - Intronic
1151404688 17:73878696-73878718 GGGTAAATACAGAGGAAGCAAGG + Intergenic
1152248991 17:79201755-79201777 GGGTGAAGACAGAGAAGGCAGGG - Intronic
1203168160 17_GL000205v2_random:118366-118388 AGTTAAACAAAGAGAACACAGGG + Intergenic
1153125939 18:1790415-1790437 AGGTGAACACTGAGAACACATGG + Intergenic
1153760394 18:8325366-8325388 AGTTAAACACTGAGAACACATGG - Intronic
1154134869 18:11767736-11767758 GGGTACACAGAGAGCAAGCATGG - Intronic
1155554887 18:27007804-27007826 GGGTGAACATGGAGAAAATAGGG + Intronic
1155623878 18:27812629-27812651 TGGAAAACACAGAGAGAAGACGG + Intergenic
1155730618 18:29153229-29153251 GTGTATACACAGAGAAAGAAGGG + Intergenic
1155943459 18:31822642-31822664 GGAGAAAAACAGAGAAGACAGGG + Intergenic
1156075137 18:33266581-33266603 GGGTGAACAAAGAGAACACATGG + Intronic
1156274309 18:35568151-35568173 GGTTAAACAAAGAGACACCAGGG - Intergenic
1156940205 18:42758167-42758189 GGTTAAACAGAGAGAAGATAGGG + Intronic
1157148810 18:45193926-45193948 GGGGAAAATCAGAGAAAATATGG - Intergenic
1157484110 18:48074801-48074823 TGGCAAACACAGAGGAAAAATGG + Intronic
1161421152 19:4176595-4176617 GGAGAAACACAGAGATAAGAAGG + Intronic
1162471061 19:10872084-10872106 GGGGACAGACAGAGAAAAGAGGG + Intronic
1163493127 19:17628683-17628705 CGGTTAACACAGATGAAACATGG + Intronic
1164595905 19:29530456-29530478 GAGTAAAGACAGAGAAACCGCGG - Intronic
1164755747 19:30688082-30688104 GATTAAACACCCAGAAAACACGG + Intronic
1165234370 19:34408700-34408722 GTGTAGACACAGACAGAACAAGG - Intronic
1165665877 19:37627517-37627539 AGCTAAACACAGAGTACACATGG - Intronic
1166499947 19:43332951-43332973 GGGTGAACATAGGGAGAACATGG - Intergenic
1168115798 19:54220923-54220945 GGGGAGACTCAGAGAAAACAGGG - Intronic
1168133724 19:54337235-54337257 GGGGAGACTCAGAGAAAACAGGG - Intronic
1168510469 19:56969454-56969476 GGGTACACACACAGAAAGCAAGG + Intergenic
1168591287 19:57637346-57637368 GGGAAAACACTCAGAAAACCAGG - Intronic
926018773 2:9476249-9476271 GGGTAGACTCAGACAAATCAAGG + Intronic
926473693 2:13294289-13294311 GGAGAAATACAGAGAAAACAGGG - Intergenic
926531610 2:14054009-14054031 GTGTAAATGCAGAGAAAAGAAGG - Intergenic
926553317 2:14326812-14326834 GGTTAAACAATGAGAACACATGG - Intergenic
926888510 2:17619259-17619281 GGTTAAAGACAGATAAAAGAAGG - Intronic
933132506 2:78690194-78690216 AGGTAAACAGTGAGAACACATGG + Intergenic
933264462 2:80167536-80167558 GAGTAAATACAGTGAAAATATGG + Intronic
934803477 2:97193010-97193032 GAGTATAGCCAGAGAAAACAAGG + Exonic
934803764 2:97196745-97196767 GGGTATAGCCAGAGAAAACAAGG + Exonic
934804181 2:97202350-97202372 GGGTATAGCCAGAGAAAACAAGG + Exonic
934804457 2:97206092-97206114 GAGTATAGCCAGAGAAAACAAGG + Exonic
934972610 2:98775160-98775182 GGGTAAGCACTGAGGAAACACGG - Intergenic
937595162 2:123663388-123663410 GAGTAAGCCAAGAGAAAACACGG + Intergenic
937946074 2:127338535-127338557 GGGTAAATAATGAGAACACATGG - Intronic
938809303 2:134837562-134837584 GGGTAAACACAGAACAATCAAGG + Intergenic
939270636 2:139934461-139934483 AGGTATAAATAGAGAAAACAAGG - Intergenic
940514758 2:154668574-154668596 TGGTAAACAAAGAAAAAAAAAGG - Intergenic
940982564 2:160019944-160019966 AAGTACACACAGAAAAAACATGG - Intronic
942069034 2:172298715-172298737 GGGTAAACGAAGGGAAAAGAGGG + Intergenic
942587779 2:177503118-177503140 GGGTAAGCAAAGAGAAAAAATGG - Intronic
942985629 2:182137703-182137725 AGGAAAACAAAAAGAAAACAGGG - Intergenic
944142406 2:196471755-196471777 GGCTAAACAATGAGAACACATGG + Intronic
944688736 2:202140526-202140548 CCCCAAACACAGAGAAAACAGGG + Intronic
945697859 2:213130912-213130934 ATGTAAACAAAGAGAATACATGG + Intronic
946139859 2:217681228-217681250 GGGCAAACCCAGAGAAGAAAGGG + Intronic
946214334 2:218172404-218172426 GTGTATGCACAGGGAAAACACGG + Intergenic
947330961 2:229029013-229029035 GAGTAAACATTGAGAACACATGG + Intronic
947589472 2:231377227-231377249 GGGGAGACCCAGAGAAGACAGGG + Intergenic
948186487 2:236025587-236025609 GTGTAAACACGGATTAAACACGG + Intronic
1169049405 20:2563200-2563222 GGGTAAATACTGCAAAAACATGG - Intronic
1170060189 20:12250720-12250742 AGGTAAACAATGAGAACACATGG - Intergenic
1170172180 20:13427603-13427625 GGGTAAACACAAAGTAAAGGAGG + Intronic
1170270291 20:14520003-14520025 AGCTAAACAATGAGAAAACATGG + Intronic
1170284821 20:14695319-14695341 GGGTAAAGACAGAGAGAAACAGG - Intronic
1171155361 20:22867419-22867441 GGGGAAACAGAAAGACAACAAGG + Intergenic
1171545935 20:26001321-26001343 GGGTGGAGACAGAGAAACCAAGG + Intergenic
1172586503 20:36089027-36089049 GGGAAAGCACAGAGTAGACATGG - Intergenic
1173064715 20:39699378-39699400 AGGCAAACACCAAGAAAACAGGG - Intergenic
1173173816 20:40748815-40748837 GTGTAAACCCAGAAAAAAGAAGG + Intergenic
1173275120 20:41573792-41573814 AAGTGAAGACAGAGAAAACATGG + Intronic
1174961681 20:55164723-55164745 GGGAAAAAAAAGAGAAACCAAGG + Intergenic
1175343350 20:58250019-58250041 GGGTAGACACTGGGGAAACAAGG + Intergenic
1176325531 21:5445691-5445713 AGTTAAACAAAGAGAACACAGGG + Intergenic
1176333388 21:5572266-5572288 AGTTAAACAAAGAGAACACACGG - Intergenic
1176394369 21:6248686-6248708 AGTTAAACAAAGAGAACACACGG + Intergenic
1176403597 21:6340771-6340793 AGTTAAACAAAGAGAACACAGGG - Intergenic
1176433560 21:6648333-6648355 AGTTAAACAAAGAGAACACAGGG + Intergenic
1176467050 21:7067488-7067510 AGTTAAACAAAGAGAACACACGG - Intronic
1176490611 21:7449266-7449288 AGTTAAACAAAGAGAACACACGG - Intergenic
1176510031 21:7689117-7689139 AGTTAAACAAAGAGAACACACGG + Intergenic
1177308816 21:19358732-19358754 GTCTAAGCACAAAGAAAACATGG + Intergenic
1177365850 21:20134716-20134738 AGGAAAACAAAGAGAAAACTGGG - Intergenic
1178015340 21:28339509-28339531 GGGTAAACACAAAGAGAAGTGGG - Intergenic
1178171267 21:30042449-30042471 AGGGAAACAGAGAGCAAACAAGG - Intergenic
1178418330 21:32422301-32422323 AGGTAAACATATGGAAAACATGG + Intronic
1178628407 21:34238236-34238258 AGGTAAACAATGAGAACACATGG + Intergenic
1179026065 21:37679565-37679587 AGGCAAACACAGAAAGAACAGGG + Intronic
1179330008 21:40390721-40390743 ACTTAAACACAGAGAGAACATGG - Intronic
1179659465 21:42865201-42865223 GGGTAAACACAGAGAAAACAAGG + Intronic
1180702606 22:17789888-17789910 GTGCAAACACAGGAAAAACACGG + Exonic
1182137958 22:27923374-27923396 GGCAAAACGCAGAGAAAGCAAGG - Intergenic
1182649659 22:31840958-31840980 GGATAAACACAGAAATAACTGGG + Intronic
1182650314 22:31846346-31846368 GGTTAAAAACAAAAAAAACATGG - Intronic
1182941764 22:34283736-34283758 GGGTGAACACAGAAACAGCATGG - Intergenic
1183438403 22:37808595-37808617 GGGTAAACTCATAGCAAGCAAGG + Intronic
1183691805 22:39394232-39394254 GGATAAGCACAGAGAACAGATGG - Intergenic
949787050 3:7753352-7753374 GGGAAAACACAGATAATCCAAGG - Intergenic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
950526609 3:13528235-13528257 GAGTAACCACAGAGAGAACCCGG + Intergenic
951325647 3:21299071-21299093 GAGTAAACAAAGACAAAAAAGGG + Intergenic
951566423 3:24016674-24016696 GGGCAAGCCCAGAGAAAAGATGG - Intergenic
952277804 3:31894367-31894389 GGAAAAGAACAGAGAAAACAAGG + Intronic
952354960 3:32575473-32575495 GGAAAAACACAAAGAGAACATGG - Intergenic
953249174 3:41227924-41227946 AGGTAAACACTGAGTACACACGG - Intronic
953266653 3:41396174-41396196 GGGTAAATAAAGACCAAACATGG - Intronic
953814027 3:46139264-46139286 GGTTAAACACAGAAAAAAGAAGG - Intergenic
953857152 3:46508139-46508161 TGATAAACACAGAGAGAACATGG + Intergenic
953929994 3:47001105-47001127 GGGTGAGCACTGAGAAAACCTGG - Exonic
954525594 3:51267931-51267953 AGGTAAACAATGAGAACACATGG + Intronic
954657833 3:52207685-52207707 AGCTAAACACTGAGAACACATGG - Intronic
954667800 3:52267762-52267784 GAGTAAACAAACAAAAAACATGG + Intronic
954926124 3:54236371-54236393 GGATAACCACAGAGGAAACTGGG + Intronic
954946330 3:54427845-54427867 AGGGTATCACAGAGAAAACAAGG - Intronic
955010514 3:55010174-55010196 AGGTAAACACTGAGTACACATGG + Intronic
955448352 3:59038066-59038088 AGGTGAACAATGAGAAAACATGG + Intronic
955539323 3:59957269-59957291 GGATACACAAAGAGAAACCAGGG + Intronic
955700118 3:61673971-61673993 AGTTGAACAAAGAGAAAACATGG + Intronic
955746326 3:62143933-62143955 GGGAAAACACAGAGAAAAGAAGG + Intronic
956166961 3:66404463-66404485 GGTTACACGCAGAGAAAACAGGG + Intronic
958454256 3:94309625-94309647 GTGTGAACACATAGAAAAAATGG + Intergenic
960495928 3:118374863-118374885 GGGTGGAGAGAGAGAAAACAGGG + Intergenic
960565664 3:119129100-119129122 AGGTGAACATTGAGAAAACATGG + Intronic
961348576 3:126282603-126282625 GGGTGATCACAGGAAAAACATGG + Intergenic
962099478 3:132326819-132326841 GGGTAACCTCAGATAAATCAAGG + Intronic
963431545 3:145211942-145211964 TAGTAAACAGAGAAAAAACAAGG - Intergenic
963869471 3:150399360-150399382 GGCTAAACCCAGGGAAGACAAGG + Intergenic
964326490 3:155552405-155552427 TGCTAAATACAGAGAAAATATGG + Intronic
964348576 3:155780305-155780327 TGGTAAAGACAAAGAAAATAAGG + Intronic
964523737 3:157594998-157595020 GTGAAAACACAGAGAGAAAATGG + Intronic
964986747 3:162751054-162751076 CGGTAAATACTAAGAAAACAAGG + Intergenic
965100389 3:164290820-164290842 AAGAAAACACAGAGAAAACTAGG + Intergenic
965340751 3:167488332-167488354 GGTTAAACACTGAGCACACATGG + Intronic
966654795 3:182343733-182343755 AGGTAAACAACGAGAACACATGG - Intergenic
966750153 3:183314119-183314141 GTGAAATCACAGAGAAAATAAGG + Intronic
966819409 3:183913365-183913387 GGGCGAACACAGTGATAACAGGG - Intergenic
967438856 3:189483053-189483075 GGGTAAACACAAAGTGAACATGG + Intergenic
967799489 3:193640364-193640386 AGGTAAACAAAAAGAAAACATGG + Intronic
969437851 4:7199024-7199046 GGGTAAGCACCCAGGAAACAAGG - Intronic
970554487 4:17217483-17217505 GGGCAAACACAGTGAAAATCTGG - Intergenic
970840860 4:20467290-20467312 GGGTAAAAACTGATAAAACCTGG - Intronic
971142418 4:23938698-23938720 GGGATCACATAGAGAAAACATGG + Intergenic
971328294 4:25662297-25662319 GGGGAACCACAGAGGAAATATGG + Intronic
971518803 4:27522653-27522675 GGGTAAACAGTCAGAAAATATGG + Intergenic
971539494 4:27798033-27798055 GGCTAAACACTGAGTACACATGG + Intergenic
971996459 4:33971895-33971917 TGGAAACCACAGAGAAAAAAAGG + Intergenic
972300848 4:37784485-37784507 GGGAAAACAGGGATAAAACAGGG - Intergenic
972381135 4:38521576-38521598 GGGAAGACACAGAGAGAAGATGG + Intergenic
972893730 4:43592787-43592809 GGTTGAACACTGAGAACACATGG + Intergenic
974144104 4:57924679-57924701 GGGTAATCAAAAGGAAAACAAGG + Intergenic
974544363 4:63281076-63281098 TGGTAAACACTGAGTAGACATGG + Intergenic
974683635 4:65195702-65195724 GGGAAAACAGAGAGGAAGCAAGG - Intergenic
974736822 4:65946529-65946551 GGGAAAACAGAGAAAAAAAATGG - Intergenic
975921914 4:79401225-79401247 TGCTAAACACATAGAGAACAAGG + Intergenic
976085329 4:81402044-81402066 GGGCAAGCACAGATAAATCAGGG + Intergenic
976354631 4:84102792-84102814 AGCTAAACACAGAGCACACATGG + Intergenic
976379501 4:84383290-84383312 GGGTAATCACAGAAAAGAGATGG + Intergenic
976581832 4:86745952-86745974 GGGAAAAAACACAGGAAACAAGG + Intronic
977760146 4:100724400-100724422 AGTTAAAAACAAAGAAAACAAGG + Intronic
978041723 4:104072661-104072683 GGGCAAAGAAAGATAAAACATGG - Intergenic
978844544 4:113256675-113256697 ATGTAAACACATAGAAAAAAAGG - Intronic
979856648 4:125640536-125640558 GATTAAACAAAAAGAAAACATGG + Intergenic
980429368 4:132671561-132671583 GAGTAAACACTGAGTACACATGG + Intergenic
980517844 4:133888021-133888043 GCTTAAACACAGAGAAAACCTGG + Intergenic
980787747 4:137576475-137576497 GAGGAAACACAAACAAAACAAGG + Intergenic
981004504 4:139861231-139861253 GGGCAAGTAAAGAGAAAACAGGG - Intronic
981150225 4:141371829-141371851 GGGTATACACAGACACAAGATGG - Intergenic
981394201 4:144227931-144227953 AGGTAAACACTGAGTACACATGG + Intergenic
981649304 4:147037997-147038019 GGGTAAGCAGTGAGAAATCAGGG + Intergenic
982603090 4:157476630-157476652 GTGAAAACAATGAGAAAACAGGG - Intergenic
982722438 4:158872371-158872393 GAGTAATGACAGAGTAAACATGG - Intronic
982969572 4:161966629-161966651 GTGAAGACACAGAGAAAACATGG + Intronic
983424613 4:167567518-167567540 GGTTGAACACTGAGAACACATGG + Intergenic
984336785 4:178402516-178402538 GGGAAGACACAGAGAAAATATGG - Intergenic
984731495 4:183072441-183072463 GGGTAAACACAGATTGAACCAGG - Intergenic
985913362 5:2899564-2899586 GGGAAAACCCAGAGCACACATGG + Intergenic
985965417 5:3335794-3335816 GGATAAAAATAGAGAAGACATGG - Intergenic
986231817 5:5871566-5871588 TAGTAAACACACAGCAAACACGG - Intergenic
986526366 5:8682637-8682659 GGGAAAGCACAGAGAGAAGATGG + Intergenic
986911275 5:12560410-12560432 AGCTAAACACTGAGAACACATGG - Intergenic
987502515 5:18731961-18731983 AGGTAAACACTGAGCACACATGG - Intergenic
988256648 5:28829384-28829406 AGGAAAAAAGAGAGAAAACAAGG - Intergenic
989290860 5:39763588-39763610 GGGTAAACACTGAGTACACATGG - Intergenic
990433931 5:55768333-55768355 AGCTAAACACTGAGAACACATGG - Intronic
990435385 5:55784856-55784878 GGCAAAACCCAGAGAAAACCAGG - Intronic
990750227 5:59006684-59006706 TGGTAAGGACTGAGAAAACAAGG - Intronic
991758727 5:69901753-69901775 GGGTCACCACTGTGAAAACAAGG - Intergenic
991911440 5:71566339-71566361 TGTTAAAAACAGAGAAAATAAGG + Exonic
992347168 5:75891243-75891265 GGGGAAACAGAGAGATAACCAGG + Intergenic
992768911 5:80028870-80028892 GGGTAAAATAAGAAAAAACAGGG - Intronic
994595729 5:101831910-101831932 AGTTAAACAATGAGAAAACATGG - Intergenic
995353999 5:111216527-111216549 AGCTAAACACTGAGTAAACATGG - Intergenic
995522535 5:113024560-113024582 GGGTAACCACTGAGGAAACTAGG + Intronic
995560586 5:113376973-113376995 GGGTAGCCACAGAGAAAAGAGGG - Intronic
995793410 5:115917557-115917579 GGGAGAACACAGAAAATACAGGG + Intergenic
996063801 5:119059904-119059926 GAGTAAACACAGAGGAGATAAGG - Intronic
996172343 5:120309608-120309630 GGATAACCACAAAGAAAATAGGG - Intergenic
996731786 5:126724165-126724187 CTGAAATCACAGAGAAAACAAGG + Intergenic
997600764 5:135136881-135136903 GAGGAAACACACACAAAACATGG - Intronic
997775004 5:136595848-136595870 GAGAAGACAAAGAGAAAACAAGG + Intergenic
998175651 5:139900513-139900535 GGGAAAACACAATGAGAACATGG + Intronic
998634232 5:143934477-143934499 TAGTAAGCACACAGAAAACATGG + Intergenic
999146006 5:149395065-149395087 AGCTAAACACTGAGAACACATGG - Intronic
999195489 5:149778769-149778791 GGGTGACCACAGATAAAACCTGG + Intronic
999394260 5:151216831-151216853 AGGTACAGACAGAGAAATCAAGG + Intronic
1000393887 5:160752468-160752490 AGGCAAACTCAGAGAAAATAAGG - Intronic
1000414210 5:160966388-160966410 GGGAAAGCACAGAGAGATCAGGG - Intergenic
1000610253 5:163365830-163365852 AGGTAAACAGAGAGATAGCATGG + Intergenic
1000815069 5:165910882-165910904 AGCTAAACACAGAAATAACAGGG + Intergenic
1003700081 6:8454021-8454043 GTGAAAACAAACAGAAAACATGG - Intergenic
1003756188 6:9123280-9123302 AGGGAAACACACATAAAACAAGG + Intergenic
1004353373 6:14910734-14910756 GGGGAACCACAGGGACAACAGGG - Intergenic
1005909973 6:30300820-30300842 GGGTAAACAAAGAGAAATTAAGG - Intergenic
1006098926 6:31673587-31673609 AGGTAAACACAGATTAAAGAGGG + Intronic
1006932126 6:37694881-37694903 GAGAAAACACAGAGAGAAAAGGG + Intronic
1006986969 6:38182310-38182332 GTGTACACACATAAAAAACAGGG - Intronic
1007873767 6:45071058-45071080 AGGTAAACAGAGACAAAATATGG - Intronic
1007920935 6:45608957-45608979 GGGTGAACAAAGTGAAAACAGGG - Intronic
1008077600 6:47161689-47161711 GGGTAAAGAAAGAGCACACAGGG - Intergenic
1008085028 6:47235430-47235452 GGGAAGACACAGTGAAGACATGG + Intronic
1008299724 6:49820743-49820765 AGGTAAACAATGAGAACACATGG + Intergenic
1008679878 6:53860971-53860993 CGCTAAACACTGAGAACACATGG + Intronic
1010534741 6:77012631-77012653 GAGTAAACATAAAGAAAACTAGG + Intergenic
1011161644 6:84397452-84397474 AGCTAAACACTGAGAACACATGG + Intergenic
1011281941 6:85686501-85686523 GGGAAAAAACAGAGAGAACAGGG + Intergenic
1012658145 6:101852303-101852325 GGGGAAAGACTGAGAATACAGGG - Intronic
1013506184 6:110802528-110802550 GGGGAAAAACAGAGGAAAAAGGG + Intronic
1013629708 6:111974611-111974633 GTGTACACAAAGAGAAAATAAGG - Intergenic
1014049279 6:116933343-116933365 GGATAAACACAGAGAATACTTGG + Intergenic
1014438860 6:121450706-121450728 GTGTAAAAATACAGAAAACAAGG + Intergenic
1015570866 6:134619999-134620021 GTCAAAACACAGAGAAAGCACGG + Intergenic
1015640690 6:135328221-135328243 GTGAGAACACAGTGAAAACATGG + Intronic
1016275700 6:142349712-142349734 GAGTAAACACACACAAAAAAAGG + Intronic
1016409043 6:143762463-143762485 AGGCTATCACAGAGAAAACAGGG + Intronic
1017180564 6:151547899-151547921 GAGGAAATACAGAGAACACACGG - Intronic
1017574599 6:155788030-155788052 AGGAAAACAAAGAGAACACAGGG + Intergenic
1017695023 6:157005978-157006000 GGGAAGACAGAGAGAAAAGAGGG - Intronic
1018142450 6:160852731-160852753 CGGTGAACCCAGAGAAAAGATGG - Intergenic
1019062937 6:169269788-169269810 GGGACAGCACAGATAAAACAGGG - Intergenic
1020514122 7:9094703-9094725 TGGTAAACATTAAGAAAACATGG + Intergenic
1022069156 7:26894028-26894050 GAGCAAAGACAGAAAAAACATGG + Intronic
1022252853 7:28626384-28626406 GGGTTAACACACATAAAACTTGG - Intronic
1022461228 7:30609538-30609560 TGTAAAAGACAGAGAAAACAAGG - Intronic
1023406376 7:39837405-39837427 GGCTAAACAATGAGAACACAGGG - Intergenic
1023719444 7:43077841-43077863 GGGAAAAAACAGGGGAAACAGGG + Intergenic
1025080952 7:55982259-55982281 GAATAAACTCAGAGAAAATAAGG + Exonic
1026190448 7:68121509-68121531 GGATAAACTCAGAGGAAAAATGG - Intergenic
1026936539 7:74259816-74259838 GGGGAAACAAACAGTAAACAAGG - Intergenic
1027366872 7:77467783-77467805 GGGTAAACAAAAACAAGACATGG - Intergenic
1027737599 7:81953509-81953531 GGGTAAACAGATAAAAAACAGGG + Intronic
1028247466 7:88498475-88498497 GGCTAAAGACAGACAAACCAGGG - Intergenic
1028464869 7:91139845-91139867 GGGAAAATAAAGAGAAAAAAAGG - Intronic
1028567784 7:92251991-92252013 GGGTCACCACACAGAATACAGGG - Intronic
1028860700 7:95646896-95646918 GGGTAAACACTGAGTATACATGG - Intergenic
1029818533 7:103122422-103122444 CGGTAGACACAGACAAAAGAGGG + Intronic
1031473411 7:122193744-122193766 GGGCAAACACTGTGAAATCAGGG + Intergenic
1031607432 7:123786447-123786469 GGGAAATAACAGAGAAAAGAAGG - Intergenic
1031772349 7:125860344-125860366 AGCTAAACAATGAGAAAACATGG - Intergenic
1031893029 7:127317166-127317188 GGCTAAACAATGAGAAAACATGG + Intergenic
1032554442 7:132817034-132817056 AGGTAAAGACAGAGAAGACAGGG - Intronic
1033321655 7:140345270-140345292 GGGAAGACACAGACAAACCATGG + Intronic
1034294676 7:149961798-149961820 AGGTAAACACATAGGAAATATGG + Intergenic
1034294686 7:149961879-149961901 AGGTAAACACATAGGAAATATGG + Intergenic
1034811379 7:154135073-154135095 AGGTAAACACATAGGAAATATGG - Intronic
1035148842 7:156849302-156849324 GGCTAAATACTGAGAACACATGG + Intronic
1035212476 7:157338305-157338327 GAGTAAACCCAGAGAGAACGCGG - Intronic
1035906553 8:3516975-3516997 GGGTGAAAACACAGAAAACAGGG + Intronic
1035958956 8:4115932-4115954 AAGTAAACACCAAGAAAACAGGG + Intronic
1036251368 8:7165663-7165685 GGGCAAACACAGGGGAAACAGGG + Intergenic
1036366121 8:8121797-8121819 GGGCAAACACAGGGGAAACAGGG - Intergenic
1036451839 8:8875308-8875330 GGATAAACAAAAAGAACACAAGG + Intronic
1036685866 8:10909738-10909760 GGTTAAACACAGGGAAGAAAAGG + Intronic
1037215841 8:16449962-16449984 AGGTAAACAATGAGAACACATGG + Intronic
1037706420 8:21319216-21319238 TGGTAAACACTGAGAGAAGATGG + Intergenic
1038124043 8:24651414-24651436 GTGAAAACACAGTGAAAACTTGG + Intergenic
1038254441 8:25937970-25937992 GGGAAAAGAAAGAGAAAAAAAGG + Intronic
1038854324 8:31314639-31314661 AGCTAAACAAAGAGAACACATGG + Intergenic
1039010282 8:33086184-33086206 GGGTTCACACAGAGAAACCAAGG + Intergenic
1039245759 8:35606627-35606649 AGCTAAACACTGAGAACACATGG - Intronic
1041437964 8:57862943-57862965 TGGTAATCACCGAGACAACAGGG + Intergenic
1042493775 8:69433453-69433475 GGTGAAACTCAGAGAAAAAAAGG + Intergenic
1042543085 8:69926734-69926756 AAGAAAATACAGAGAAAACATGG + Intergenic
1042955919 8:74250519-74250541 GGGTAACCACTGAGGAAGCAGGG - Intronic
1043166445 8:76908841-76908863 GGGAAGACACAGGGAAGACAGGG - Intergenic
1044921835 8:97176316-97176338 AGGCAAACCCAGAGAAAAGAGGG - Intergenic
1045329918 8:101146751-101146773 GGGTAGAAACAGAGAGGACAAGG + Intergenic
1046299142 8:112263177-112263199 GGGTAAGCATAGAGATAAAAGGG - Intronic
1046837982 8:118824479-118824501 ATGTGAACACAGAGAAAAGATGG + Intergenic
1047657041 8:126989261-126989283 GGGTGAACACAGATAAACAAGGG - Intergenic
1048128693 8:131666937-131666959 GGCTAAACACTGAGTATACATGG + Intergenic
1048527065 8:135212974-135212996 GGCTAAAGACAGAGGGAACAGGG - Intergenic
1048880191 8:138866055-138866077 GGGTAAATTCAAAGAAACCAGGG + Intronic
1049073169 8:140372726-140372748 GTGAGAACACAGAGAAAAGACGG + Intronic
1049202524 8:141347260-141347282 GGGAAAGCCCAGAGAAAATAGGG + Intergenic
1049785192 8:144447324-144447346 AAGGAAACACAGACAAAACATGG + Intergenic
1050007149 9:1144014-1144036 AGGTCAACCCAGATAAAACATGG + Intergenic
1050185235 9:2966000-2966022 GGGAAGACACAGAGAAAAGAAGG + Intergenic
1052079837 9:24190835-24190857 AGCAAAACACAGAGAAAATATGG + Intergenic
1052320852 9:27165782-27165804 GGGCAAACCCAGAGAGAGCACGG - Intronic
1052643710 9:31204260-31204282 GAGTAGACAGAGGGAAAACATGG - Intergenic
1052825101 9:33168235-33168257 GGGTAAACCTGTAGAAAACATGG - Intergenic
1053472820 9:38359041-38359063 GGGAGAACACAGAAAACACAAGG + Intergenic
1055117986 9:72625798-72625820 GTGTAAGGACAGACAAAACAAGG - Intronic
1055669255 9:78584155-78584177 TGGAAAGCTCAGAGAAAACACGG + Intergenic
1056121086 9:83489857-83489879 CGATAAACACAGAGAAATGAAGG + Intronic
1056411610 9:86333922-86333944 AGGGAAACACAGAGGCAACAAGG - Intronic
1056448414 9:86689350-86689372 GGGTAAGTAAAGGGAAAACATGG - Intergenic
1056540268 9:87565011-87565033 GGGAAAACACAGTGAAAACCAGG + Intronic
1057728898 9:97591570-97591592 AGGTACAAACACAGAAAACAAGG - Intronic
1058161855 9:101578781-101578803 GGGAAAAAGCAGAGAGAACAGGG + Intronic
1058246169 9:102628125-102628147 GAGTCAACACACACAAAACATGG - Intergenic
1058255517 9:102757430-102757452 TGCTAAACATAGAGAAAACTGGG - Intergenic
1058747532 9:108006766-108006788 CTGTAAACACAGAGAAATCAAGG - Intergenic
1059195481 9:112367019-112367041 TGGTAACCACAAAGAAAGCAGGG - Intergenic
1060548225 9:124473096-124473118 GGGAAAACACAGAGAGACCTTGG - Intronic
1060741903 9:126104262-126104284 GGGGACACAGAGAGAAACCAGGG + Intergenic
1060784660 9:126441154-126441176 GAGTAAATACAGAGGAAAAAGGG - Intronic
1062679806 9:137772854-137772876 GGGAAAAAAGAGATAAAACAAGG - Intronic
1203428309 Un_GL000195v1:62956-62978 AGTTAAACAAAGAGAACACACGG + Intergenic
1203437976 Un_GL000195v1:160337-160359 AGTTAAACAAAGAGAACACAGGG - Intergenic
1185940040 X:4307598-4307620 GGAAAAAAAAAGAGAAAACATGG - Intergenic
1186098420 X:6128607-6128629 GGCTAAACACTGAGTACACATGG + Intronic
1187430656 X:19221382-19221404 GGGAAAACACAAACAAAACGTGG - Intergenic
1188543958 X:31281615-31281637 TGGAAAACTCAGAGAAAACATGG - Intronic
1188728944 X:33622047-33622069 GGGAAAAAGCTGAGAAAACATGG + Intergenic
1189380192 X:40497204-40497226 GGGAAAACACAGAGAGGAGAAGG + Intergenic
1189456454 X:41194992-41195014 GGGTCATCAGAGAGAAAATATGG + Intronic
1189493442 X:41488007-41488029 GGGTTCACACAGTGAACACATGG + Intergenic
1189926753 X:45962809-45962831 GGTTAAACACTGAGTACACATGG + Intergenic
1190003299 X:46710254-46710276 AGGTAAACAGAGTGAAAGCAGGG + Intronic
1190061080 X:47212074-47212096 GGGGGAACACAGAGGATACAGGG - Intronic
1191783801 X:64896113-64896135 GGGTAAAGTCAGAGGAAACCAGG - Intergenic
1193605411 X:83561968-83561990 AGGTAAACAATGAGAACACATGG - Intergenic
1194229874 X:91308379-91308401 AGCTAAACAATGAGAAAACATGG + Intergenic
1194289118 X:92047312-92047334 GGTTACACCCATAGAAAACAGGG - Intronic
1194589866 X:95786789-95786811 GGGTAAAAACTAAGAAAATATGG - Intergenic
1194817972 X:98468461-98468483 GAGAAAACACAGAAAAAACAAGG - Intergenic
1194871712 X:99140838-99140860 GTGTCCACACAGAGAAGACATGG - Intergenic
1196329037 X:114446967-114446989 GGGCAAAAAAAGAGAAAAAAAGG - Intergenic
1197538810 X:127728272-127728294 GAGTACACACAGAGGAAACTGGG - Intergenic
1197943017 X:131809343-131809365 GGGAAAAAACAGAATAAACAAGG - Intergenic
1197989702 X:132304718-132304740 GGGTAAACACAAGCAGAACATGG - Intergenic
1198319262 X:135503676-135503698 GGCTAAACATTGAGAACACATGG - Intergenic
1198551045 X:137744969-137744991 AAGTAAACACAGAGAAAATCAGG - Intergenic
1198562760 X:137868662-137868684 GGAAAAACACAGAGGAAACAAGG + Intergenic
1199398655 X:147370766-147370788 AGGTAAACACTGAGCACACATGG - Intergenic
1199473185 X:148217913-148217935 GGGTGAAAACAGCAAAAACAAGG + Intergenic
1199995106 X:153019097-153019119 AGGTAAACACTGAGTACACATGG + Intergenic
1200037894 X:153345242-153345264 GGGTGGACAGAGAGAAGACAGGG + Intronic
1200298665 X:154949741-154949763 GTGTACACACAGAGACACCAGGG - Intronic
1200606634 Y:5271890-5271912 GGTTACACCCATAGAAAACAGGG - Intronic
1200778153 Y:7188779-7188801 GTAGAAACACAGTGAAAACAAGG - Intergenic
1201486901 Y:14504414-14504436 AGGTAAACAAAGAAAAAATATGG + Intergenic