ID: 1179663320

View in Genome Browser
Species Human (GRCh38)
Location 21:42892449-42892471
Sequence CAAGATAAACTGGCGGAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179663320_1179663325 7 Left 1179663320 21:42892449-42892471 CCTCATTCCGCCAGTTTATCTTG 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1179663325 21:42892479-42892501 AATGAATCGCTAGCTGTGTCAGG 0: 1
1: 0
2: 1
3: 0
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179663320 Original CRISPR CAAGATAAACTGGCGGAATG AGG (reversed) Intronic
900353038 1:2246084-2246106 AAAGAAAAACGGGCTGAATGCGG - Intronic
900875305 1:5338344-5338366 CAAAATAAACTGGAGGAGAGTGG - Intergenic
912554539 1:110506733-110506755 CAAGATAAACTGGCCCTGTGTGG - Intergenic
919277715 1:195442962-195442984 CAAGAAGAAATGGAGGAATGTGG - Intergenic
1065853914 10:29814384-29814406 GAAGATAAAATGGAGAAATGGGG + Intergenic
1066652910 10:37676355-37676377 CAAGAGAAACAGCAGGAATGAGG - Intergenic
1066690126 10:38018211-38018233 CAAGTTAGATTGGCTGAATGTGG + Intronic
1073707632 10:106003244-106003266 CAAGATAAACAGGAAGACTGGGG + Intergenic
1075448360 10:122529603-122529625 CCAGATGAAGTGGTGGAATGGGG - Intergenic
1078617942 11:12882251-12882273 CAATATAAACTGGCCAAATTAGG + Intronic
1086562805 11:88187751-88187773 CAAGGTGAACTGGTGGAATGAGG - Intergenic
1086817779 11:91394589-91394611 CAAAGTAAACTGGGGGGATGGGG - Intergenic
1088836365 11:113580879-113580901 ACATATAAACTGGGGGAATGTGG - Intergenic
1091133948 11:133170997-133171019 CCAGATAGACTGTAGGAATGAGG + Intronic
1092282223 12:7106902-7106924 ATAGGTAAACTGGCAGAATGAGG + Intronic
1095114231 12:38332766-38332788 CAAGATGAACTCGCCTAATGGGG + Intergenic
1097740430 12:63235606-63235628 CAAGATAAACTTGCTGCAAGAGG - Intergenic
1105441963 13:20422732-20422754 CATGACAAACTGTTGGAATGTGG - Intronic
1107896770 13:44972646-44972668 TAAGATAAACTGGGGGAGGGAGG + Intronic
1112837140 13:103530016-103530038 CAAGAGAAAATGGAGGAATTGGG + Intergenic
1117196084 14:53341461-53341483 CAAGATTGCCTGGAGGAATGTGG + Intergenic
1117380822 14:55161053-55161075 CAAGACTAACTGATGGAATGAGG + Intronic
1127440496 15:59002017-59002039 GATGATAAAATGGCGAAATGAGG + Intronic
1127726607 15:61756728-61756750 AAAGATAAAATGGCCAAATGGGG - Intergenic
1127821635 15:62662764-62662786 CAAGATAAAAAGGCAGAAAGGGG + Intronic
1128515028 15:68336662-68336684 CAAGATTATCTGGCAGAAAGTGG - Intronic
1138903773 16:61305271-61305293 CAAGAAAAACTGGCGGTTTTTGG - Intergenic
1139443989 16:66985455-66985477 TAAGAGAATCTGGCAGAATGAGG + Intergenic
1148435286 17:47679363-47679385 CAAGCTAAATTGGAGGACTGGGG + Intronic
1152041645 17:77907509-77907531 CAAGAAATACTTGTGGAATGAGG - Intergenic
1154031408 18:10756889-10756911 CAGGATAAAAAGGAGGAATGGGG + Intronic
1157345885 18:46832598-46832620 AAAGATTAACTGGCCGGATGTGG + Intronic
1158296705 18:56004769-56004791 CAAGATAAGCTCATGGAATGTGG + Intergenic
1160463721 18:79058428-79058450 CAAGAAAAATTGGCCGGATGCGG + Intergenic
1163244219 19:16082789-16082811 CAAGACCAACTGGGGCAATGTGG + Intronic
1165176797 19:33936330-33936352 CAAGATCACCTGGAGGCATGTGG + Intergenic
1166348433 19:42181451-42181473 AAAGATGAACAGGCAGAATGAGG - Intronic
1168391057 19:56008299-56008321 CATGATAAACTGGGTGGATGGGG + Intronic
928474437 2:31611985-31612007 AAGGATAAACTGGCTGAGTGTGG + Intergenic
932751871 2:74376366-74376388 AAGGATAGACTGGGGGAATGGGG - Intronic
933451404 2:82457553-82457575 AAAGATAACCTGGCTGAATATGG + Intergenic
935803696 2:106726219-106726241 CAAGAGAAACGGGAGGAGTGGGG - Intergenic
936826444 2:116587520-116587542 TAGGAAAAACTGGCAGAATGTGG + Intergenic
937579921 2:123472765-123472787 CAAGATAAACTTGGGGATTCTGG - Intergenic
943880346 2:193136595-193136617 AGATATAAACTGGCTGAATGGGG + Intergenic
946610920 2:221456784-221456806 CAAGATAAAATTGGGGAAGGTGG + Intronic
948059268 2:235031563-235031585 CCAGGTAAGCTGGCGGAACGCGG - Intronic
1169574584 20:6943857-6943879 CAAGATAAGCTGGCTGGGTGAGG + Intergenic
1172508744 20:35484513-35484535 AAAGAGAAACTGGAGGGATGTGG - Intronic
1175904353 20:62372250-62372272 CAGGGGAAACAGGCGGAATGGGG + Intergenic
1179663320 21:42892449-42892471 CAAGATAAACTGGCGGAATGAGG - Intronic
949480490 3:4489905-4489927 CAAGATAAGCTGGAGAAAGGAGG - Intergenic
951487984 3:23235480-23235502 CAAGATGAGGTGGCAGAATGAGG + Intronic
953191933 3:40696060-40696082 CAAGGTTAGCTGACGGAATGTGG - Intergenic
953550688 3:43900243-43900265 CAAGGGAACCTGGGGGAATGTGG + Intergenic
953550851 3:43901393-43901415 CAAGGGAACCTGGGGGAATGTGG - Intergenic
958907387 3:99956814-99956836 GAAGAGAAACTGGCAGAGTGGGG - Intronic
965976645 3:174632484-174632506 CAAGATAAAATGCTGGAATGGGG + Intronic
966921059 3:184611611-184611633 AAAGAGAAACTGGAGAAATGGGG - Intronic
967626356 3:191689333-191689355 GAAGAAAAGCTGGAGGAATGTGG + Intergenic
968343215 3:197976920-197976942 CAAGATAAACAGGGGCAAGGAGG - Intronic
971357863 4:25911221-25911243 AAAGAAAAACTGGAGGAGTGTGG + Intronic
971707998 4:30073127-30073149 CAAAGAAAACTGTCGGAATGTGG - Intergenic
976088397 4:81429759-81429781 CAGGACAGACTGGCGGGATGAGG + Intronic
981440773 4:144779255-144779277 CAAGATGAACTTGAGCAATGAGG - Intergenic
983518039 4:168677811-168677833 CAGGATTAACTGGCGGAGTAGGG - Intronic
989557191 5:42811358-42811380 GAAGAAAAAGTGGTGGAATGGGG - Intronic
996532227 5:124538191-124538213 CAAGATAAAATGCCAGGATGGGG + Intergenic
996747531 5:126858141-126858163 AGAGAGAAACTGGCTGAATGGGG + Intergenic
1001489945 5:172148267-172148289 CATGATCAACTGAAGGAATGAGG + Intronic
1002302552 5:178265636-178265658 CAAGGTAGACTGGCTGAGTGGGG - Intronic
1004917256 6:20343416-20343438 CAAAATAATGTGGCTGAATGTGG + Intergenic
1005112883 6:22303981-22304003 CAAGATAACCTGGAGAAAGGAGG - Intergenic
1010111129 6:72234477-72234499 CAAGGTAAACAGGTGGAAAGGGG - Intronic
1011732009 6:90274528-90274550 CAAGACAAGCTGGCGGAAGTGGG + Intronic
1015665366 6:135622523-135622545 CAAGATTTACTGGTGGCATGTGG - Intergenic
1025270192 7:57504310-57504332 ATAGATAAACTGGTGGCATGGGG + Intergenic
1030130052 7:106191784-106191806 CAAGAGAAACTGGTGGAATTTGG + Intergenic
1037268777 8:17101569-17101591 GGAGAAAAACTGGCCGAATGAGG + Intronic
1037325970 8:17691082-17691104 CAAGAGACACTGGAGGAATATGG - Intronic
1037351769 8:17967071-17967093 CAAAATAAACTGGGAGAAGGAGG - Exonic
1048370510 8:133772532-133772554 CAAGAGAAACTGAGGAAATGAGG - Intergenic
1048487609 8:134863201-134863223 CAAAATAAATTAGCTGAATGTGG - Intergenic
1053054003 9:34983081-34983103 CCAGATAAAAGGGAGGAATGGGG - Intergenic
1055707142 9:79017992-79018014 CCAGATGAAGTGACGGAATGTGG - Intergenic
1056068449 9:82961247-82961269 CCACATAAACTTGGGGAATGGGG - Intergenic
1058519904 9:105806962-105806984 CAAGATATACAGGAGGAAAGAGG - Intergenic
1059131587 9:111756961-111756983 CAAGAGGTACTGGAGGAATGGGG + Intronic
1059584854 9:115595166-115595188 CAAGACAAACAGGAGGTATGAGG - Intergenic
1061922409 9:133789321-133789343 CAAGTGAAACTGGAGGAATTTGG - Exonic
1185956946 X:4501413-4501435 CAAGATAATGTGGCTGAGTGTGG - Intergenic
1186817893 X:13255984-13256006 CAGGAGAAACTGGTGGAATGGGG - Intergenic
1192081075 X:68048507-68048529 AAAGGTAAATTGGGGGAATGGGG + Intronic
1194166965 X:90529043-90529065 CAAGATAAACTGGGGGATCCTGG - Intergenic
1195961841 X:110395041-110395063 CTAGATAAACTGCCAGGATGTGG + Intronic
1197710488 X:129663261-129663283 AAAGACAAACAGGAGGAATGGGG - Intergenic
1199866570 X:151855458-151855480 CTAGATAAACTGGTAGAATGGGG + Intergenic
1200513232 Y:4106819-4106841 CAAGATAAACTGGGGGATCCTGG - Intergenic
1201610784 Y:15840632-15840654 CAAGAAAGACTGACTGAATGTGG - Intergenic