ID: 1179667010

View in Genome Browser
Species Human (GRCh38)
Location 21:42919903-42919925
Sequence CTGCCCGGGTACCTTGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179667003_1179667010 18 Left 1179667003 21:42919862-42919884 CCATTTATGGGGCAGCATGTGAA No data
Right 1179667010 21:42919903-42919925 CTGCCCGGGTACCTTGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179667010 Original CRISPR CTGCCCGGGTACCTTGCCCT GGG Intergenic
No off target data available for this crispr