ID: 1179667511

View in Genome Browser
Species Human (GRCh38)
Location 21:42922944-42922966
Sequence AGGGTAACCCTGATAATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179667511_1179667520 9 Left 1179667511 21:42922944-42922966 CCTGCCATTATCAGGGTTACCCT No data
Right 1179667520 21:42922976-42922998 TGAGGCAATGGTAGTTGCCGGGG No data
1179667511_1179667517 -3 Left 1179667511 21:42922944-42922966 CCTGCCATTATCAGGGTTACCCT No data
Right 1179667517 21:42922964-42922986 CCTTGGCTCAGATGAGGCAATGG No data
1179667511_1179667521 22 Left 1179667511 21:42922944-42922966 CCTGCCATTATCAGGGTTACCCT No data
Right 1179667521 21:42922989-42923011 GTTGCCGGGGTGTCCGTTCCAGG No data
1179667511_1179667514 -9 Left 1179667511 21:42922944-42922966 CCTGCCATTATCAGGGTTACCCT No data
Right 1179667514 21:42922958-42922980 GGTTACCCTTGGCTCAGATGAGG No data
1179667511_1179667518 7 Left 1179667511 21:42922944-42922966 CCTGCCATTATCAGGGTTACCCT No data
Right 1179667518 21:42922974-42922996 GATGAGGCAATGGTAGTTGCCGG No data
1179667511_1179667522 23 Left 1179667511 21:42922944-42922966 CCTGCCATTATCAGGGTTACCCT No data
Right 1179667522 21:42922990-42923012 TTGCCGGGGTGTCCGTTCCAGGG No data
1179667511_1179667519 8 Left 1179667511 21:42922944-42922966 CCTGCCATTATCAGGGTTACCCT No data
Right 1179667519 21:42922975-42922997 ATGAGGCAATGGTAGTTGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179667511 Original CRISPR AGGGTAACCCTGATAATGGC AGG (reversed) Intergenic
No off target data available for this crispr