ID: 1179667569

View in Genome Browser
Species Human (GRCh38)
Location 21:42923176-42923198
Sequence GCAATGAAGGCCACCGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179667569_1179667578 20 Left 1179667569 21:42923176-42923198 CCTGGACCGGTGGCCTTCATTGC No data
Right 1179667578 21:42923219-42923241 GGTGCAGGTGGCTTGCTAGGAGG No data
1179667569_1179667574 5 Left 1179667569 21:42923176-42923198 CCTGGACCGGTGGCCTTCATTGC No data
Right 1179667574 21:42923204-42923226 TTGAAACAGACGCCAGGTGCAGG No data
1179667569_1179667575 8 Left 1179667569 21:42923176-42923198 CCTGGACCGGTGGCCTTCATTGC No data
Right 1179667575 21:42923207-42923229 AAACAGACGCCAGGTGCAGGTGG No data
1179667569_1179667573 -1 Left 1179667569 21:42923176-42923198 CCTGGACCGGTGGCCTTCATTGC No data
Right 1179667573 21:42923198-42923220 CCACACTTGAAACAGACGCCAGG No data
1179667569_1179667577 17 Left 1179667569 21:42923176-42923198 CCTGGACCGGTGGCCTTCATTGC No data
Right 1179667577 21:42923216-42923238 CCAGGTGCAGGTGGCTTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179667569 Original CRISPR GCAATGAAGGCCACCGGTCC AGG (reversed) Intergenic