ID: 1179667574

View in Genome Browser
Species Human (GRCh38)
Location 21:42923204-42923226
Sequence TTGAAACAGACGCCAGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179667569_1179667574 5 Left 1179667569 21:42923176-42923198 CCTGGACCGGTGGCCTTCATTGC No data
Right 1179667574 21:42923204-42923226 TTGAAACAGACGCCAGGTGCAGG No data
1179667571_1179667574 -8 Left 1179667571 21:42923189-42923211 CCTTCATTGCCACACTTGAAACA No data
Right 1179667574 21:42923204-42923226 TTGAAACAGACGCCAGGTGCAGG No data
1179667570_1179667574 -1 Left 1179667570 21:42923182-42923204 CCGGTGGCCTTCATTGCCACACT No data
Right 1179667574 21:42923204-42923226 TTGAAACAGACGCCAGGTGCAGG No data
1179667566_1179667574 22 Left 1179667566 21:42923159-42923181 CCTGGGTTTGGGCATTGCCTGGA No data
Right 1179667574 21:42923204-42923226 TTGAAACAGACGCCAGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179667574 Original CRISPR TTGAAACAGACGCCAGGTGC AGG Intergenic