ID: 1179667577

View in Genome Browser
Species Human (GRCh38)
Location 21:42923216-42923238
Sequence CCAGGTGCAGGTGGCTTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179667572_1179667577 -5 Left 1179667572 21:42923198-42923220 CCACACTTGAAACAGACGCCAGG No data
Right 1179667577 21:42923216-42923238 CCAGGTGCAGGTGGCTTGCTAGG No data
1179667569_1179667577 17 Left 1179667569 21:42923176-42923198 CCTGGACCGGTGGCCTTCATTGC No data
Right 1179667577 21:42923216-42923238 CCAGGTGCAGGTGGCTTGCTAGG No data
1179667570_1179667577 11 Left 1179667570 21:42923182-42923204 CCGGTGGCCTTCATTGCCACACT No data
Right 1179667577 21:42923216-42923238 CCAGGTGCAGGTGGCTTGCTAGG No data
1179667571_1179667577 4 Left 1179667571 21:42923189-42923211 CCTTCATTGCCACACTTGAAACA No data
Right 1179667577 21:42923216-42923238 CCAGGTGCAGGTGGCTTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179667577 Original CRISPR CCAGGTGCAGGTGGCTTGCT AGG Intergenic