ID: 1179669084

View in Genome Browser
Species Human (GRCh38)
Location 21:42932834-42932856
Sequence GCCCACTCCATTTGAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 2, 1: 0, 2: 1, 3: 2, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179669084 Original CRISPR GCCCACTCCATTTGAGTGGA AGG Intergenic
901505707 1:9684142-9684164 GCCCACTAGATTTAAGAGGAGGG + Intronic
904818853 1:33227274-33227296 GCCCACTCAATTCCAGGGGATGG - Intergenic
910428609 1:87139603-87139625 GTCCACTCCACTTCAGTGGAGGG - Intronic
910429088 1:87143383-87143405 GCCCACCTCATTGGAGTGCAGGG + Intronic
910684603 1:89903250-89903272 GCACTCTCCATTTGAGTTGTTGG + Intronic
912255114 1:108050415-108050437 TCCCAGTGCATTTCAGTGGAGGG - Intergenic
915016816 1:152742151-152742173 GCCCACTCCATTTGGCTGTTTGG - Intronic
915243475 1:154540533-154540555 GCTTTCTCCATTTGAGTGAACGG - Intronic
915349405 1:155215042-155215064 GGCCACTTCAGGTGAGTGGAGGG - Intergenic
915352591 1:155235669-155235691 GGCCACTTCAGGTGAGTGGAGGG - Exonic
916462413 1:165040224-165040246 GTACACTCCTTTAGAGTGGAGGG + Intergenic
916993793 1:170273987-170274009 GGCCACTCCATTTGAGTATCTGG + Intergenic
922358168 1:224796074-224796096 TCCCTCTCCTCTTGAGTGGAAGG + Intergenic
924946408 1:248849799-248849821 GCCTGCTCTATTTGAGTGTAAGG + Intergenic
1070729762 10:78818404-78818426 GCACAGCCAATTTGAGTGGAGGG + Intergenic
1075659677 10:124184685-124184707 GCACAGTCCATTCTAGTGGATGG + Intergenic
1075999589 10:126904810-126904832 TTCCACCCCATTTGAGTGGCCGG + Intergenic
1080700541 11:34640408-34640430 GCCCAGCCCATTTGCATGGAGGG - Intronic
1086427153 11:86696574-86696596 GCCTACTCCATTTGAGCTCATGG - Intergenic
1093338483 12:17939886-17939908 GCCCACTCCACTTAACTTGAAGG - Intergenic
1096230697 12:49895328-49895350 GTCCACTCCATTGGGGGGGATGG - Intronic
1097032305 12:56098496-56098518 GCAGACTCCAATTAAGTGGATGG + Exonic
1100455798 12:94750525-94750547 TCCCACTCCACTGAAGTGGAGGG + Intergenic
1100511914 12:95283876-95283898 GCCATCTCCACTTGAGTGGGTGG + Intronic
1101421963 12:104557611-104557633 GCCCTCTCCCTTTGAGAGCAAGG - Intronic
1101970901 12:109311273-109311295 CCCCACTCCTTTTTAGTGGGAGG - Intergenic
1109406410 13:61906076-61906098 CCGCACTCCAGTTAAGTGGATGG - Intergenic
1112086837 13:96041008-96041030 GCTCTGTCCATTTGAGTGGGAGG - Intronic
1120393693 14:83941600-83941622 GACCACTGTAATTGAGTGGAAGG + Intergenic
1121169341 14:91840182-91840204 GCCCACTAACTTTGATTGGATGG + Intronic
1121732972 14:96198947-96198969 CCCCACTCCCTGTGAGAGGAAGG + Intergenic
1125981216 15:44003054-44003076 GCCTACCCCATTTCAGTTGATGG + Intronic
1129838140 15:78726883-78726905 GCCCACTCCAGGAGAGGGGAGGG - Intronic
1131274937 15:90973033-90973055 GTCGAGTCCACTTGAGTGGATGG - Intronic
1131976936 15:97956331-97956353 ACCCACTCCAAGTGAGTGGGAGG + Intergenic
1132434080 15:101782283-101782305 GCCCACTCTAAGAGAGTGGAGGG + Intergenic
1137916395 16:52435119-52435141 GCTAACTGCATTTGAGGGGATGG + Intergenic
1146618246 17:34373991-34374013 GCCCAGGGCATTTGGGTGGAGGG - Intergenic
1153505038 18:5788366-5788388 GTGCAATCCAGTTGAGTGGATGG - Intergenic
1156084540 18:33382824-33382846 CCCCTTTCCATGTGAGTGGATGG - Intronic
1160331855 18:78000620-78000642 GCACACTCCATGTGAGAGAAGGG - Intergenic
1161000708 19:1909410-1909432 GGCCACTCCACTGGAGAGGAAGG - Intronic
1166033188 19:40148232-40148254 CCCCACTCCCTATGCGTGGAAGG - Intergenic
1168613050 19:57816012-57816034 GCCCACTCCATTTGAGTGGAAGG + Intronic
1168634417 19:57984474-57984496 GTCCCCTCCATTAGAGTGGGTGG + Intronic
928861552 2:35863142-35863164 GCAGACTCCATTGAAGTGGATGG + Intergenic
939087500 2:137739002-137739024 GCCCATGCCATATGATTGGAAGG - Intergenic
943394706 2:187319817-187319839 GCCAACTCCATTTGAGGAAACGG + Intergenic
943772223 2:191730887-191730909 GCCTTCTCTATTTCAGTGGATGG - Intergenic
944170919 2:196776541-196776563 CCCCACTCCATTTGGATGCAAGG - Exonic
1171144216 20:22767484-22767506 GCCCACCAGATTTGAGGGGAGGG - Intergenic
1172274864 20:33673976-33673998 GCCCACCCCATTTGTGTGTCTGG - Intronic
1174532880 20:51227957-51227979 GCCATCCCCATTAGAGTGGATGG + Intergenic
1179669084 21:42932834-42932856 GCCCACTCCATTTGAGTGGAAGG + Intergenic
1179732289 21:43374590-43374612 GCCCACTCCAACAGAGGGGATGG - Intergenic
1182669973 22:31987554-31987576 CACCACTCCACTTGGGTGGAAGG - Intergenic
951353780 3:21639279-21639301 GCCGCCTGCATTTTAGTGGAGGG - Intronic
957196201 3:77071625-77071647 GCAGAATCCATTTGAGGGGAAGG + Intronic
959531803 3:107441656-107441678 TCCCAGTCCATTCGAGTGAATGG - Intergenic
966870442 3:184286944-184286966 TCCCCGTCCACTTGAGTGGATGG + Intronic
967024667 3:185554336-185554358 TCCCACCCCATTTGAGTAGCAGG + Intergenic
968472436 4:788237-788259 CCCCCCTCCATTTGGGAGGAAGG - Intronic
968803632 4:2758475-2758497 GCCCTCTCCAGTGGATTGGAGGG - Intergenic
973662022 4:53117876-53117898 TCCCAATCCATCTGATTGGATGG - Intronic
977669307 4:99677508-99677530 GCCTTTTCCATTTCAGTGGATGG + Intergenic
987629896 5:20456458-20456480 GCATATTTCATTTGAGTGGAGGG - Intronic
990955351 5:61333456-61333478 CCCCACGCGATTTGAGGGGAGGG + Intronic
991609522 5:68435955-68435977 GGCAACTCCATTTGAGTGGCAGG - Intergenic
993328702 5:86570372-86570394 GCCCACTTTATTTGAGTGGAAGG - Intergenic
996586881 5:125098939-125098961 CTCAACTCCATTTGAGTGCACGG + Intergenic
1002960521 6:1910549-1910571 GCCCCCTCCCTTTGAATAGAAGG + Intronic
1005940559 6:30556594-30556616 GCCCCCTCCAGGTGAGTGGTAGG - Exonic
1007111555 6:39315947-39315969 GGCCACTACCTTTGGGTGGAAGG + Intronic
1018307794 6:162476369-162476391 GCCCACTCTTTTTGAGGGTAGGG + Intronic
1023427412 7:40053081-40053103 GACTACTCCATTAGAGTTGAAGG - Intronic
1027770742 7:82403015-82403037 GCCAACTAAATTTGGGTGGAAGG + Intronic
1028509635 7:91610110-91610132 GCCCTCTCCCTCTGACTGGATGG - Intergenic
1031885616 7:127243074-127243096 GCCCATTCCATACGGGTGGATGG - Exonic
1038532758 8:28331744-28331766 GCCCACTCCACTGGGGTGGGTGG - Intronic
1038619606 8:29128436-29128458 TCAAACTCCATTTGAGTGGCTGG + Intronic
1038696363 8:29810305-29810327 ACCCCCTCCTTTTGATTGGACGG + Intergenic
1043303983 8:78771079-78771101 TCCCACTCCATTTGTGGAGAGGG + Intronic
1055503083 9:76921060-76921082 GCCCACTCAATGTAAGTTGAAGG - Intergenic
1187956191 X:24521397-24521419 GGCCCCTCCATTTGACTAGAAGG + Intronic
1192846611 X:74912421-74912443 TACCACTCTATTTGAGTAGAGGG - Intronic
1198800641 X:140444665-140444687 GCCCACATCATTTGTGTGCATGG + Intergenic
1199952442 X:152716530-152716552 CCCCACTCTACTTGGGTGGAGGG - Intronic
1199957241 X:152751918-152751940 CCCCACTCTACTTGGGTGGAGGG + Intronic