ID: 1179674761

View in Genome Browser
Species Human (GRCh38)
Location 21:42974196-42974218
Sequence CCGGCTACACACACCTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179674756_1179674761 4 Left 1179674756 21:42974169-42974191 CCGCCTGCTCGAGGCAAATGGTT No data
Right 1179674761 21:42974196-42974218 CCGGCTACACACACCTCTCCTGG No data
1179674752_1179674761 9 Left 1179674752 21:42974164-42974186 CCTCCCCGCCTGCTCGAGGCAAA No data
Right 1179674761 21:42974196-42974218 CCGGCTACACACACCTCTCCTGG No data
1179674757_1179674761 1 Left 1179674757 21:42974172-42974194 CCTGCTCGAGGCAAATGGTTTCG No data
Right 1179674761 21:42974196-42974218 CCGGCTACACACACCTCTCCTGG No data
1179674748_1179674761 14 Left 1179674748 21:42974159-42974181 CCCTCCCTCCCCGCCTGCTCGAG No data
Right 1179674761 21:42974196-42974218 CCGGCTACACACACCTCTCCTGG No data
1179674753_1179674761 6 Left 1179674753 21:42974167-42974189 CCCCGCCTGCTCGAGGCAAATGG No data
Right 1179674761 21:42974196-42974218 CCGGCTACACACACCTCTCCTGG No data
1179674751_1179674761 10 Left 1179674751 21:42974163-42974185 CCCTCCCCGCCTGCTCGAGGCAA No data
Right 1179674761 21:42974196-42974218 CCGGCTACACACACCTCTCCTGG No data
1179674755_1179674761 5 Left 1179674755 21:42974168-42974190 CCCGCCTGCTCGAGGCAAATGGT No data
Right 1179674761 21:42974196-42974218 CCGGCTACACACACCTCTCCTGG No data
1179674749_1179674761 13 Left 1179674749 21:42974160-42974182 CCTCCCTCCCCGCCTGCTCGAGG No data
Right 1179674761 21:42974196-42974218 CCGGCTACACACACCTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179674761 Original CRISPR CCGGCTACACACACCTCTCC TGG Intergenic
No off target data available for this crispr