ID: 1179677311

View in Genome Browser
Species Human (GRCh38)
Location 21:42992570-42992592
Sequence TGGGGGTGACGTAATGACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 106}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179677301_1179677311 19 Left 1179677301 21:42992528-42992550 CCTCCAGGATGTCTGAGTCCTCA 0: 1
1: 1
2: 1
3: 26
4: 182
Right 1179677311 21:42992570-42992592 TGGGGGTGACGTAATGACTGAGG 0: 1
1: 0
2: 2
3: 10
4: 106
1179677302_1179677311 16 Left 1179677302 21:42992531-42992553 CCAGGATGTCTGAGTCCTCAGCT 0: 1
1: 0
2: 10
3: 51
4: 317
Right 1179677311 21:42992570-42992592 TGGGGGTGACGTAATGACTGAGG 0: 1
1: 0
2: 2
3: 10
4: 106
1179677300_1179677311 27 Left 1179677300 21:42992520-42992542 CCGTCTCTCCTCCAGGATGTCTG 0: 1
1: 0
2: 1
3: 48
4: 450
Right 1179677311 21:42992570-42992592 TGGGGGTGACGTAATGACTGAGG 0: 1
1: 0
2: 2
3: 10
4: 106
1179677305_1179677311 1 Left 1179677305 21:42992546-42992568 CCTCAGCTGGGACGACTCAGCGG 0: 1
1: 0
2: 0
3: 19
4: 144
Right 1179677311 21:42992570-42992592 TGGGGGTGACGTAATGACTGAGG 0: 1
1: 0
2: 2
3: 10
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179677311 Original CRISPR TGGGGGTGACGTAATGACTG AGG Intronic
906289394 1:44610095-44610117 GGGAGGTGAGGTAATGAATGTGG + Intronic
911477492 1:98391380-98391402 TGGGTGTGACATAATGTCTAGGG - Intergenic
912393491 1:109321330-109321352 TGGGGGTGAAGCAGGGACTGTGG + Intronic
915531512 1:156504982-156505004 TGGGGGTGATGCACTGACCGAGG - Intergenic
915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG + Intergenic
919916622 1:202143551-202143573 TGAGGCTGCCGTAATGGCTGCGG - Intronic
920379014 1:205525067-205525089 TGGGGGAGGCGTCATGTCTGTGG + Intronic
1065886309 10:30080654-30080676 GGGGGCTGTCCTAATGACTGGGG - Intronic
1067581326 10:47447839-47447861 TGGGGGTGAGGAAAAGGCTGTGG + Intergenic
1083435354 11:62639310-62639332 TGGGGGTGGGGCAATGGCTGTGG - Intronic
1084791532 11:71478068-71478090 TGGGGGTGTCTTACTGACAGGGG + Intronic
1085645196 11:78218261-78218283 TGGGGGTGATGCAGGGACTGAGG - Exonic
1086483138 11:87266978-87267000 TGGAGGTGATGTAAGAACTGAGG + Intronic
1088699934 11:112402847-112402869 TGGGGGTGACAAAATGACCTGGG - Intergenic
1088738180 11:112745806-112745828 TGGAGGTGACATAATGCATGTGG - Intergenic
1090416800 11:126546063-126546085 TGTGTGTAAAGTAATGACTGTGG + Intronic
1091437131 12:481579-481601 CTGCGGTGAGGTAATGACTGGGG - Intronic
1100138036 12:91579218-91579240 TGGGGGTGAGGTGATGTCAGTGG - Intergenic
1100772601 12:97939909-97939931 TGTGGGTGACTCAATGACTGGGG + Intergenic
1102361400 12:112290983-112291005 TGAGGGTGAAGTAATGATGGAGG - Intronic
1104309431 12:127641156-127641178 TGGGTGTGAAATATTGACTGTGG + Intergenic
1105606722 13:21932119-21932141 TGGGGGTGGAGTGAGGACTGGGG + Intergenic
1110243405 13:73293950-73293972 GTGGGGAGGCGTAATGACTGTGG - Intergenic
1110462960 13:75766547-75766569 TGGGGTTCACATTATGACTGGGG + Intronic
1110694766 13:78475148-78475170 TGGGGGTGAATCAATAACTGGGG + Intergenic
1113007274 13:105721590-105721612 TGTGGGTGACGACATGACAGAGG + Intergenic
1114258453 14:21021505-21021527 AGGGGGTGACATAATCCCTGAGG - Intronic
1114767096 14:25385603-25385625 TGGGGGTGAGGTAGGGATTGGGG + Intergenic
1115093110 14:29602343-29602365 GGGGAGAGACGCAATGACTGGGG + Intronic
1117020240 14:51562968-51562990 TGGGGGTGATTTGATGACTCAGG + Intronic
1117105750 14:52395618-52395640 TGGGGGTGTCCTGGTGACTGAGG - Intergenic
1118879643 14:69815416-69815438 GGGGGTTGATGTCATGACTGTGG - Intergenic
1122222203 14:100246845-100246867 TGGGGGTGAAGTGATTACTTTGG - Intronic
1124608645 15:31192702-31192724 TGGGGGAGACTTTGTGACTGCGG - Intergenic
1126498662 15:49320617-49320639 TGGGAGTGTGGCAATGACTGAGG - Intronic
1130975220 15:88768680-88768702 TGGGGGTGACTTGATGGCTGGGG - Intergenic
1131044807 15:89305539-89305561 TGGGGGTAATATAATAACTGTGG - Intronic
1132464985 16:73271-73293 AGGGGGAGGGGTAATGACTGTGG - Intronic
1134763682 16:16736891-16736913 TGAGGGTGACTTGATGGCTGGGG + Intergenic
1134982372 16:18622266-18622288 TGAGGGTGACTTGATGGCTGGGG - Intergenic
1139489417 16:67278690-67278712 TGGGGTTGCCGTGAGGACTGGGG - Exonic
1139529407 16:67535706-67535728 TGGGGGTGATGGAAAGCCTGAGG + Intronic
1140066302 16:71614335-71614357 TGGGGGTCACCTGATGGCTGGGG + Intergenic
1140941120 16:79722796-79722818 TGGGGGTGGGGTGATGACGGTGG + Intergenic
1141486361 16:84342931-84342953 TGGGGGTGACGGCATGACTGAGG + Intergenic
1141982871 16:87560883-87560905 TGGGGATGAGGCCATGACTGTGG + Intergenic
1143508339 17:7381695-7381717 TGGAGGAGAGGCAATGACTGTGG + Intronic
1143697594 17:8631367-8631389 CGGGGGTGACGTCAGGACTCTGG - Intergenic
1147286955 17:39409942-39409964 TGGGGGTGAGGTACTGGTTGTGG + Exonic
1152017462 17:77761089-77761111 TGGGGGTGGGGTAGGGACTGGGG + Intergenic
1152780662 17:82226205-82226227 TGGGGGAGAAGTCAAGACTGGGG + Intergenic
1154164203 18:12001916-12001938 TGGGGGTGACACACAGACTGGGG - Intronic
1155185219 18:23381804-23381826 TGAGGGTGACGGTAGGACTGAGG - Intronic
1156904781 18:42339773-42339795 TGAGGTTGACGTAGTAACTGTGG - Intergenic
1158137800 18:54224855-54224877 TGGGGGTGTCATAGTGACTGTGG + Intergenic
1160462829 18:79052328-79052350 TGGGGGTGCAGCAAGGACTGTGG + Intergenic
1166103268 19:40583689-40583711 TGGGGGTGAGGTAGACACTGAGG - Exonic
1167686314 19:50958961-50958983 TGGGGAGGACGTGATGAGTGAGG - Exonic
926388763 2:12365411-12365433 TGGGGGTAACTTAAAGACTGAGG + Intergenic
928272500 2:29869056-29869078 TGGGGGTGACTTAATGGCTGGGG - Intronic
936251094 2:110868975-110868997 TGGGGGTGACATTGTGACAGTGG + Intronic
941370383 2:164657361-164657383 TGGGGATGACTCAATGACTGTGG - Intronic
944116687 2:196194823-196194845 TGTGGTGAACGTAATGACTGAGG + Exonic
945812872 2:214569665-214569687 TGGGGTTGAAGTGATGAGTGAGG - Intronic
946908848 2:224441610-224441632 TGGGGGAGGGGTAAGGACTGGGG + Intergenic
1169858615 20:10129474-10129496 TGGGGGGGATGGCATGACTGGGG - Intergenic
1172703523 20:36866266-36866288 TGGGGCTGACGTAGGGGCTGTGG + Intergenic
1173419993 20:42892715-42892737 TGGGGGAGACGTCAGCACTGGGG + Intronic
1176079191 20:63263146-63263168 TGGGGGAGAAGCACTGACTGGGG - Intronic
1176105542 20:63384151-63384173 TGGAGGTGACGAAAGGAGTGGGG - Intergenic
1179677311 21:42992570-42992592 TGGGGGTGACGTAATGACTGAGG + Intronic
1182786176 22:32909624-32909646 TGGGGGTGAGGTAAGGGGTGGGG - Intronic
952280581 3:31919373-31919395 TCGGGGTGACTTACTGAATGAGG + Intronic
954139452 3:48597316-48597338 ATGGGGTGAGGTAGTGACTGAGG - Intergenic
955527736 3:59838395-59838417 TGGGGGTGAGGGAATAAATGTGG - Intronic
955819907 3:62885803-62885825 TGGGGGTTACCTGATCACTGAGG + Intergenic
956452897 3:69391866-69391888 TGTGGTTGTCCTAATGACTGGGG - Intronic
968880973 4:3299974-3299996 TGGGGGTGAGGTGAAGACCGCGG - Intronic
977182536 4:93894641-93894663 TGGGGGTGACATAAAGCCTGGGG - Intergenic
980587669 4:134838418-134838440 GAGGAGTGACATAATGACTGTGG + Intergenic
982098916 4:151949525-151949547 TGGGGTTGATGTAATCACAGGGG + Intergenic
986746898 5:10753083-10753105 AGGTGGTGATGTAATGACGGAGG - Intronic
987699715 5:21381379-21381401 TGGGGCTGACGTGGTGACCGTGG - Intergenic
988714970 5:33816504-33816526 TGGGGGTGAAGGGAAGACTGGGG - Intronic
988752687 5:34206674-34206696 TGGGGCTGACGTGGTGACCGTGG + Intergenic
991740457 5:69667488-69667510 TGGGGCTGACGTGGTGACCGTGG + Intergenic
991757042 5:69885679-69885701 TGGGGCTGACGTGGTGACCGTGG - Intergenic
991792032 5:70247229-70247251 TGGGGCTGACGTGGTGACCGTGG + Intergenic
991819918 5:70543593-70543615 TGGGGCTGACGTGGTGACCGTGG + Intergenic
991836445 5:70761561-70761583 TGGGGCTGACGTGGTGACCGTGG - Intergenic
991884479 5:71247555-71247577 TGGGGCTGACGTGGTGACCGTGG + Intergenic
992268395 5:75040398-75040420 TGGGGGTAAAGTAGTGAGTGAGG - Intergenic
999378968 5:151106696-151106718 TGGAGGTGATGTCATGACTGGGG - Intronic
1004251333 6:14025425-14025447 GGGGAGTGATGTAATGATTGAGG - Intergenic
1005550852 6:26913394-26913416 TGGGGCTGACGTGGTGACCGTGG + Intergenic
1006996742 6:38268126-38268148 TAGGGGTGAAGTACTGGCTGGGG - Intronic
1013378948 6:109547103-109547125 TGGGGGTCATTTAAGGACTGTGG - Intronic
1013988187 6:116221957-116221979 TAGGGGAGACCTAATGACTCAGG - Intronic
1016085154 6:139904331-139904353 TGGTGATGACATAATGAATGTGG + Intergenic
1017537847 6:155367486-155367508 TGGGGGAGAAGTAATAAATGTGG + Intergenic
1018923526 6:168191685-168191707 TTGGGGTGACTTAGTGCCTGGGG + Intergenic
1019352611 7:562038-562060 TGGGGGTGACGAGATGCCTGTGG + Intronic
1032303568 7:130712082-130712104 TGGAGGTGAAGGAATGACAGTGG - Intergenic
1033339193 7:140478970-140478992 GGGGGTTGACGCAGTGACTGGGG + Intronic
1034999266 7:155598840-155598862 TGGGGCTGAAATGATGACTGAGG - Intergenic
1036221271 8:6923242-6923264 TGGGGGTGACCTAGTGAGTGAGG - Intergenic
1036221281 8:6923280-6923302 TGGGGGTGACCTAGTAAGTGGGG - Intergenic
1036221322 8:6923419-6923441 TGGGGGTGACCTAGTGAGTGAGG - Intergenic
1042130111 8:65579661-65579683 TGGGGGTGAAGACATGGCTGAGG - Intergenic
1042290222 8:67163140-67163162 TGGGGGTCACTTGATGACTTTGG + Intronic
1046094226 8:109539245-109539267 TTGAGGTGGCGGAATGACTGAGG + Intergenic
1046711654 8:117517770-117517792 TGTGGGTGCTGTAATGAGTGTGG + Intergenic
1048691456 8:136969334-136969356 TGGGGGTGAAGAAAGGACAGAGG - Intergenic
1049143659 8:140981201-140981223 TGGTGGTGACATAAAGTCTGAGG - Intronic
1051403115 9:16705119-16705141 TGGGGGTGACTTAGAGACTCAGG - Intronic
1189600830 X:42623258-42623280 TGGGGGTGACTTAACAGCTGGGG - Intergenic
1194634607 X:96329253-96329275 TGGGTGTGACCTAATAGCTGTGG - Intergenic
1199483437 X:148323620-148323642 GGGGGGTGACTTGATAACTGGGG + Intergenic
1199783631 X:151084574-151084596 TGGGGGTCAGGTAATGATAGAGG + Intergenic