ID: 1179681606

View in Genome Browser
Species Human (GRCh38)
Location 21:43025417-43025439
Sequence GTGGCAGAGGGTCCCCTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 115}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179681606_1179681613 -8 Left 1179681606 21:43025417-43025439 CCCATGAGGGGACCCTCTGCCAC 0: 1
1: 0
2: 0
3: 7
4: 115
Right 1179681613 21:43025432-43025454 TCTGCCACTCTTTCTTGTGGGGG 0: 1
1: 0
2: 2
3: 18
4: 145
1179681606_1179681617 16 Left 1179681606 21:43025417-43025439 CCCATGAGGGGACCCTCTGCCAC 0: 1
1: 0
2: 0
3: 7
4: 115
Right 1179681617 21:43025456-43025478 CCTGCTCCACAGAAGAGTCTGGG 0: 1
1: 0
2: 1
3: 12
4: 223
1179681606_1179681612 -9 Left 1179681606 21:43025417-43025439 CCCATGAGGGGACCCTCTGCCAC 0: 1
1: 0
2: 0
3: 7
4: 115
Right 1179681612 21:43025431-43025453 CTCTGCCACTCTTTCTTGTGGGG 0: 1
1: 0
2: 3
3: 21
4: 241
1179681606_1179681615 15 Left 1179681606 21:43025417-43025439 CCCATGAGGGGACCCTCTGCCAC 0: 1
1: 0
2: 0
3: 7
4: 115
Right 1179681615 21:43025455-43025477 TCCTGCTCCACAGAAGAGTCTGG 0: 1
1: 0
2: 4
3: 32
4: 238
1179681606_1179681611 -10 Left 1179681606 21:43025417-43025439 CCCATGAGGGGACCCTCTGCCAC 0: 1
1: 0
2: 0
3: 7
4: 115
Right 1179681611 21:43025430-43025452 CCTCTGCCACTCTTTCTTGTGGG 0: 1
1: 0
2: 3
3: 27
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179681606 Original CRISPR GTGGCAGAGGGTCCCCTCAT GGG (reversed) Intronic
900481663 1:2902458-2902480 GTGGAATGGGGTCCTCTCATGGG + Intergenic
900600783 1:3501854-3501876 GTGGCAGGGGGCCCCCCCACAGG + Exonic
900604257 1:3516798-3516820 GGCGCTGAGGGTCCCCTCCTGGG + Intronic
900706969 1:4086963-4086985 GTGGCTGCAGGGCCCCTCATAGG - Intergenic
901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG + Intergenic
904604856 1:31692669-31692691 GGGGCAGAGGGTCACCTGATGGG + Intronic
915313685 1:155016855-155016877 GGGGCAGAGGCTCCCCAAATTGG + Exonic
915590156 1:156866237-156866259 GAGGCAGAGGGTCCCAGCAGCGG + Intronic
917276240 1:173334817-173334839 GTGGGAGTGGGTCCCCTGAGGGG - Intergenic
921447003 1:215258753-215258775 GTCATAGAGGGTCTCCTCATAGG + Intergenic
922169234 1:223141379-223141401 ATGGCAGAGGATCACCTCTTTGG - Intronic
1063515900 10:6694913-6694935 GTGGCTGAGAATCCCCTCCTTGG - Intergenic
1067460949 10:46458144-46458166 GTGGCAGAGGGTCCACTTGCTGG + Intergenic
1067626244 10:47926456-47926478 GTGGCAGAGGGTCCACTTGCTGG - Intergenic
1067758991 10:49029104-49029126 TTGACAGAGGGTCTCCTCAATGG + Intronic
1069902300 10:71713205-71713227 TTGGCCGAGGCTCCCCTCTTGGG + Exonic
1072803162 10:98407459-98407481 GTGGAAGAGGGAGCCCTCAGGGG + Intronic
1075400144 10:122155172-122155194 GTGGGAGGGGCTCCCCTCAGTGG - Intronic
1076356313 10:129856107-129856129 GTGGCAGAGGGTGACCTGTTGGG - Intronic
1077092728 11:786990-787012 GTGACAGGGGGTCCCGTCAGAGG + Intergenic
1077140026 11:1020212-1020234 GTGGTGGAGGTTCCCGTCATGGG + Exonic
1081776182 11:45677464-45677486 CTGGCAGAGGGACCCTTCACAGG - Intergenic
1083013470 11:59426444-59426466 GTGGCAGAGGGCAGCCTCTTGGG - Intergenic
1090067457 11:123515522-123515544 GAGGCAGAGGCTCTCCTTATAGG + Intergenic
1091196317 11:133733826-133733848 GTGTCACAGGGACCCCTCAGAGG - Intergenic
1091364519 11:135006635-135006657 GAGGCCGAGTGTCCCCTCAGAGG - Intergenic
1091796061 12:3298026-3298048 GGGGCTGAGGGTCCCCGCCTAGG + Intergenic
1094509677 12:31088712-31088734 GTGGCAAAGGGTCCCCACTTGGG - Intronic
1094844191 12:34354269-34354291 GTGGCAGAGGTCCCCCCCATGGG - Intergenic
1094848562 12:34372227-34372249 ACGGCAGAGGGACCCCCCATGGG - Intergenic
1094850169 12:34378789-34378811 ATGGCAGAGGTCCCCCCCATGGG - Intergenic
1094850865 12:34381780-34381802 GTGGCAGAGGTCCCCCCCAAGGG - Intergenic
1094851517 12:34384371-34384393 GAGGCAGAGGTCCCCCTCACGGG - Intergenic
1094855799 12:34402262-34402284 GCGGCAGAGGTTCCCCGCACAGG + Intergenic
1094871339 12:34600845-34600867 GTGGCAGAGGTTCGCCCCAAGGG + Intergenic
1096244022 12:49974459-49974481 GTGGCACTGGGCCACCTCATTGG + Exonic
1101587103 12:106094710-106094732 CTGGCAGTGGGTGGCCTCATTGG - Intronic
1102172384 12:110852234-110852256 GGGGCAGTGTGTCCCCTGATGGG - Intronic
1103561373 12:121794769-121794791 GTGGCAGAGGGACCCCCCCCTGG + Intronic
1104790535 12:131479044-131479066 GTGGCAGAGGTTCGCCACAGAGG - Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1110523823 13:76512793-76512815 GGGGCATATGGTCCCTTCATTGG + Intergenic
1113591842 13:111506888-111506910 GAGGCAGATGGTGCCCTCAGGGG - Intergenic
1118826125 14:69383462-69383484 GTGGCAGTGGGTTACCTCTTTGG + Intronic
1124421765 15:29529181-29529203 GTGGCAGAGGGTCCACATAAAGG + Intronic
1126092010 15:45061172-45061194 CCGGCAGAGGTTCCCGTCATCGG - Exonic
1128940622 15:71784945-71784967 GAGGCAGAGGGTCCCAGCCTGGG - Intergenic
1133282771 16:4676529-4676551 GCGGTAGAGGGGCCCCTCACAGG + Intronic
1133324283 16:4934082-4934104 GTGGCAGCGGGTCTCCTCCAGGG + Intronic
1136479755 16:30534128-30534150 GTGGCAGAGGGTACCGGGATGGG + Intronic
1136483624 16:30557664-30557686 GTGGCAGAGGGTACCGGGATGGG + Intronic
1137687698 16:50398208-50398230 GTGGCATAGGCTCCTCTCAATGG + Intergenic
1137689042 16:50407582-50407604 GTGTCAGAGGATCCCACCATGGG + Intergenic
1137786244 16:51140086-51140108 GTGGCAGATGATGCACTCATTGG + Exonic
1141681235 16:85545153-85545175 CAGGCAGAGGGTCCCTTCACAGG + Intergenic
1142425716 16:90001277-90001299 GTGGCGGGGGGTGCCCTGATGGG - Intergenic
1148830732 17:50429356-50429378 GTAGGAGAGGATCCCCTGATTGG + Intronic
1152894183 17:82901276-82901298 AGGTCAGAGGGTCCCCTCCTAGG + Intronic
1153844121 18:9033217-9033239 GTGGCAGAGAGTCCCCACTACGG + Intergenic
1155091885 18:22520126-22520148 GTGGCAGAGGGACCCTTGCTTGG + Intergenic
1160097648 18:75889973-75889995 CTGGCAGAGCCTCCCCTCCTTGG + Intergenic
1162039760 19:7963678-7963700 CTGCCAGAGGATCCCCTCGTCGG + Exonic
1162757499 19:12868960-12868982 GTGGCAGAGCAGCCTCTCATTGG - Intronic
1163632309 19:18423816-18423838 GTGACACAGGGAGCCCTCATAGG + Intronic
1163754658 19:19099473-19099495 CAGGCAGAGGGTGCCCTCTTTGG - Intronic
1164244930 19:23420576-23420598 GAGGCAGAGCCTCCCCTCACAGG + Intergenic
1164842822 19:31406269-31406291 CTGGCTGAGAGTCCCCTCCTGGG - Intergenic
925413000 2:3650730-3650752 GTGACAGTGGGTACCCACATGGG - Intergenic
926119952 2:10236385-10236407 GTGGAAGACGGGCCCCTCAATGG - Intergenic
926312100 2:11682218-11682240 GTGGCAGAGTGTCACCTCCAGGG - Intronic
927310407 2:21624712-21624734 TTGGCAAAGGGTTCCCTCACGGG - Intergenic
932172009 2:69565885-69565907 GTGGCAGAGTGTCCTCTCCACGG + Intronic
936440825 2:112551327-112551349 GTGGCAGGAGGTCTCCTCATGGG + Intronic
936451914 2:112640271-112640293 GGGCTAGAGGGTCCCATCATTGG + Intergenic
938950943 2:136253940-136253962 GGGCCAGTGGGTACCCTCATAGG + Intergenic
946021442 2:216643071-216643093 GTGGCATCGGGTGCCCTCACTGG - Intronic
948151907 2:235751290-235751312 CTGGCAGAGGGTCCCCTTGCTGG + Intronic
948992104 2:241560476-241560498 GAGGCAGCGTGTCCCCTCACGGG - Intronic
1169299880 20:4432757-4432779 TTAGCAGAGGGTGACCTCATGGG + Intergenic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1171343261 20:24446784-24446806 GTGGCAGAAAATCCCCTCTTGGG - Intergenic
1173003582 20:39123103-39123125 GAGGCAAAGGGACCCCTCAGGGG + Intergenic
1173421354 20:42904223-42904245 TTGGCAGAGGCTGCTCTCATAGG - Intronic
1174671738 20:52314371-52314393 ATGGCAGAGTGGCCCCTCACAGG + Intergenic
1175756515 20:61533589-61533611 CAGCCAGAGGGGCCCCTCATGGG - Intronic
1179681606 21:43025417-43025439 GTGGCAGAGGGTCCCCTCATGGG - Intronic
1181529913 22:23511556-23511578 GTGCCTGAAGGTCCCCTCTTGGG + Intergenic
1182555382 22:31126008-31126030 TTGGGAGAGGGCCCCCTCACCGG - Exonic
1183954114 22:41369002-41369024 AAGGTAGAGGGTCCCCTCCTTGG + Intronic
1184874747 22:47267129-47267151 CTGGCACTGGGTCCCCTCCTTGG + Intergenic
949288712 3:2438003-2438025 GAGGCAGGGCATCCCCTCATAGG - Intronic
949605189 3:5645172-5645194 ATGGCACAGGGGCCCCTCTTAGG - Intergenic
954367459 3:50154262-50154284 TGGGCAGAGGGTCCCTTCCTGGG + Intergenic
955069073 3:55557228-55557250 GTGGCAGATGGCCCCCCCAGTGG + Intronic
956705480 3:71995448-71995470 GTGGCAGAGGGGCCCCACTCTGG + Intergenic
958771256 3:98428634-98428656 GTGGCAGGAGGTGCCTTCATTGG - Intergenic
970848079 4:20566974-20566996 GTGTCACAGAGTCCCCTCATGGG - Intronic
976671980 4:87663896-87663918 GTTGCATAGGGTTTCCTCATTGG + Exonic
978370231 4:108022546-108022568 GTGGCAGAGGGTGGAGTCATGGG + Intronic
984889095 4:184475171-184475193 GTGGCTGAGGGTGCCACCATTGG + Intergenic
996552110 5:124741930-124741952 TTGGCACAGGGGCCCCTCAAAGG - Intronic
1002461091 5:179374212-179374234 GGGGCAGAGAGTCCCTTGATGGG - Intergenic
1006134844 6:31888979-31889001 GGGGGAGAGGGTCCCCTCGCTGG + Exonic
1006260147 6:32861147-32861169 CTGGGAGAGGGGCCCCTCCTGGG + Intergenic
1015392608 6:132700157-132700179 ATGGCAGATGGTCTCCACATTGG + Intronic
1018805305 6:167254662-167254684 CAGGCAGAGGGTCACCTCAAGGG - Intergenic
1024587798 7:50856506-50856528 GTGGCAGCGGGTGCCATCAATGG - Intergenic
1032074184 7:128828619-128828641 GTAACAGGGGGTGCCCTCATTGG + Intergenic
1034745537 7:153520511-153520533 GTGGCATAAGGTCACCTCTTTGG - Intergenic
1037911410 8:22745814-22745836 GTGGCAGAGGGAGAGCTCATGGG - Intronic
1039128382 8:34230806-34230828 TTAGCAGAGGTTCCCCTAATGGG + Intergenic
1040987711 8:53314651-53314673 GGGGCAGAGAGGCCTCTCATAGG + Intergenic
1045795904 8:106043869-106043891 CTTGCAGATGGTCCCCTTATAGG + Intergenic
1046876973 8:119265893-119265915 CTGCTAGAGAGTCCCCTCATGGG - Intergenic
1048026996 8:130596264-130596286 ATGGCAGAGGGCCCCCGCAATGG - Intergenic
1049671214 8:143870751-143870773 GGGGCAGAGGGTCTCCGCGTGGG - Exonic
1058502545 9:105635539-105635561 GTGGGGGAGGGTTCCCTCAAAGG - Exonic
1060961301 9:127682699-127682721 GGGGCAAAGGGTTCCCTCCTTGG + Intronic
1187512863 X:19937982-19938004 CTGGCTCAGGGTCCCCTCACTGG + Intronic
1188434490 X:30145444-30145466 GTGGCAGAGGGTCTACACAGCGG - Intergenic
1199146891 X:144379421-144379443 GTGGCAGAGTGCACACTCATTGG + Intergenic
1200210291 X:154344137-154344159 GTGGCAGAGTCTCCCTTCTTGGG - Intergenic
1200220561 X:154387955-154387977 GTGGCAGAGTCTCCCTTCTTGGG + Intergenic