ID: 1179683339

View in Genome Browser
Species Human (GRCh38)
Location 21:43039510-43039532
Sequence GGCCATGCCCGTCGTGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179683332_1179683339 13 Left 1179683332 21:43039474-43039496 CCGGTTCTCTGTCATGTCACATT No data
Right 1179683339 21:43039510-43039532 GGCCATGCCCGTCGTGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179683339 Original CRISPR GGCCATGCCCGTCGTGTGCT GGG Intergenic
No off target data available for this crispr