ID: 1179684307

View in Genome Browser
Species Human (GRCh38)
Location 21:43045065-43045087
Sequence AGCCTGAGACTGCTGCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179684297_1179684307 26 Left 1179684297 21:43045016-43045038 CCGATTGTGACGGAGCGTGAGAC No data
Right 1179684307 21:43045065-43045087 AGCCTGAGACTGCTGCAGCAGGG No data
1179684305_1179684307 -9 Left 1179684305 21:43045051-43045073 CCAGGGGAGGTGGCAGCCTGAGA No data
Right 1179684307 21:43045065-43045087 AGCCTGAGACTGCTGCAGCAGGG No data
1179684303_1179684307 3 Left 1179684303 21:43045039-43045061 CCTTGCAGACAGCCAGGGGAGGT No data
Right 1179684307 21:43045065-43045087 AGCCTGAGACTGCTGCAGCAGGG No data
1179684301_1179684307 4 Left 1179684301 21:43045038-43045060 CCCTTGCAGACAGCCAGGGGAGG No data
Right 1179684307 21:43045065-43045087 AGCCTGAGACTGCTGCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179684307 Original CRISPR AGCCTGAGACTGCTGCAGCA GGG Intergenic
No off target data available for this crispr