ID: 1179686640

View in Genome Browser
Species Human (GRCh38)
Location 21:43058581-43058603
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 2, 1: 0, 2: 0, 3: 18, 4: 253}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179686640_1179686648 -8 Left 1179686640 21:43058581-43058603 CCAGGACAGCCTGCACACAAAGG 0: 2
1: 0
2: 0
3: 18
4: 253
Right 1179686648 21:43058596-43058618 CACAAAGGGTGGGTGGGCTGAGG 0: 2
1: 0
2: 0
3: 43
4: 409
1179686640_1179686650 0 Left 1179686640 21:43058581-43058603 CCAGGACAGCCTGCACACAAAGG 0: 2
1: 0
2: 0
3: 18
4: 253
Right 1179686650 21:43058604-43058626 GTGGGTGGGCTGAGGTCTGAGGG 0: 2
1: 0
2: 5
3: 59
4: 453
1179686640_1179686652 16 Left 1179686640 21:43058581-43058603 CCAGGACAGCCTGCACACAAAGG 0: 2
1: 0
2: 0
3: 18
4: 253
Right 1179686652 21:43058620-43058642 CTGAGGGCCTGGAGTGAGCACGG 0: 2
1: 0
2: 8
3: 61
4: 438
1179686640_1179686651 5 Left 1179686640 21:43058581-43058603 CCAGGACAGCCTGCACACAAAGG 0: 2
1: 0
2: 0
3: 18
4: 253
Right 1179686651 21:43058609-43058631 TGGGCTGAGGTCTGAGGGCCTGG 0: 2
1: 0
2: 5
3: 88
4: 641
1179686640_1179686649 -1 Left 1179686640 21:43058581-43058603 CCAGGACAGCCTGCACACAAAGG 0: 2
1: 0
2: 0
3: 18
4: 253
Right 1179686649 21:43058603-43058625 GGTGGGTGGGCTGAGGTCTGAGG 0: 2
1: 0
2: 1
3: 98
4: 851

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179686640 Original CRISPR CCTTTGTGTGCAGGCTGTCC TGG (reversed) Intronic
900517192 1:3088147-3088169 CCTGTGTGTGCAAGCTGCACCGG - Intronic
903225102 1:21890236-21890258 TCTTTGGGTACAGGCTGTCCCGG - Intronic
903568518 1:24286709-24286731 CCTTGGGGTGCAGGCCTTCCAGG + Intergenic
905211045 1:36374379-36374401 GCTTTCTCTGCAGGCTCTCCTGG + Intronic
905343647 1:37296642-37296664 CCTAAGTGTGCAGGCTGTCTCGG - Intergenic
906003686 1:42449525-42449547 CCTTTGTGTGCAAGCATGCCTGG - Intronic
906217668 1:44053277-44053299 CCCTTATGTGCAGGCTTTTCTGG + Intergenic
906636084 1:47411656-47411678 CATCTGTGTCCAGGCTGCCCTGG - Intergenic
907306811 1:53517830-53517852 CCTTGGTGTGGAGGCTGGACAGG - Intronic
909133324 1:71766988-71767010 CCTTGTTCTGCAGGCTGTACAGG - Intronic
910788215 1:91022622-91022644 CCTTTCAGGGCAGGCTGTCCGGG - Intergenic
912732079 1:112116030-112116052 CCTCTGTGAGTAGGTTGTCCAGG + Intergenic
912812613 1:112805433-112805455 TCATTGGGTGCAGGCTGGCCTGG + Intergenic
915225966 1:154411615-154411637 GCTTTGAGGGCAGGCAGTCCAGG + Intronic
916469785 1:165111992-165112014 CTTTGTTGTGGAGGCTGTCCTGG + Intergenic
918524376 1:185449781-185449803 CCTTTGTGTAACAGCTGTCCTGG + Intergenic
920293107 1:204938067-204938089 ACGTTCTGGGCAGGCTGTCCTGG - Intronic
922290941 1:224208401-224208423 CATTTGTGCAGAGGCTGTCCTGG - Intergenic
924833735 1:247627715-247627737 CCTTTTTGGGAAGGCTTTCCAGG + Intergenic
1063621233 10:7651001-7651023 CCATTGTGTGCATCCTGTTCAGG - Intronic
1064300964 10:14122465-14122487 CCTGGGTCTGCAGGCTGTGCAGG + Intronic
1064377804 10:14812768-14812790 CTTTTGACTGCAAGCTGTCCAGG - Intergenic
1065318190 10:24484910-24484932 ACTTTCTGTGTAGGCTGTTCTGG - Intronic
1066246684 10:33590660-33590682 CCCTTTTGTGCATGATGTCCTGG + Intergenic
1067294948 10:44970270-44970292 CCTTGGTGTGCAGGTTGGGCGGG + Intronic
1071906650 10:90181687-90181709 CATTTGTGAGCAGGCTTCCCAGG + Intergenic
1072705940 10:97681041-97681063 CCCTTGTTTCCAGGCTGTGCTGG - Intronic
1073886592 10:108046915-108046937 CATGTGTCTGCAGGCTGTACAGG + Intergenic
1074406832 10:113187252-113187274 CTTTGGTGAGCAGGCCGTCCGGG + Intergenic
1076495810 10:130896985-130897007 CATGTGAGTGAAGGCTGTCCAGG - Intergenic
1076889974 10:133278667-133278689 TCCTTGTCTGCAGGCTGTGCAGG - Exonic
1076908779 10:133377317-133377339 CCTTTGCTGGAAGGCTGTCCAGG - Intergenic
1076945658 10:133647803-133647825 CTTTTATGAGCAGGCTGCCCTGG - Intergenic
1077413236 11:2413162-2413184 TCTCCGTGTCCAGGCTGTCCAGG + Exonic
1077498902 11:2900085-2900107 CCTTTCTGTGCAGTCCTTCCAGG + Intronic
1078183760 11:9033816-9033838 CCTTTGTGTCCACACTGACCAGG - Intronic
1078525900 11:12101038-12101060 CCATTGAGTGAAGGCTGTGCTGG - Intronic
1080645765 11:34186515-34186537 CCTTTGTCTGCAGTCTTGCCAGG - Intronic
1081905789 11:46668832-46668854 CATCTGAGTGCAGGCTGCCCTGG - Exonic
1081995979 11:47364414-47364436 CTTTAGTGAGGAGGCTGTCCTGG + Intronic
1084423399 11:69071720-69071742 CCTTCCTGTGCGGCCTGTCCCGG + Intronic
1084859558 11:72009378-72009400 CCTTTCTTCTCAGGCTGTCCAGG - Exonic
1086276656 11:85137771-85137793 CATTTGTGTGCCTGCTGTTCTGG - Intronic
1087824447 11:102749215-102749237 CCTTTTTGGGAAGGCTTTCCAGG + Intergenic
1088150751 11:106742205-106742227 CTTTTATGTGCAGGATGTGCAGG + Intronic
1089076519 11:115742987-115743009 CCTGTCTGTGCAGGCTGTCTGGG - Intergenic
1089520250 11:119058419-119058441 CCTTTCTGTGAAGGGTGGCCAGG - Intergenic
1090621466 11:128564551-128564573 GCTGTGAGTGGAGGCTGTCCTGG - Intronic
1091347341 11:134864241-134864263 CCTTTGTGGGGAGGAGGTCCAGG + Intergenic
1091589395 12:1834474-1834496 CTTCTGTGGGCAGGCTGTGCTGG - Exonic
1091899349 12:4132683-4132705 CCTTTGTGGGCAAACAGTCCAGG - Intergenic
1093620194 12:21278704-21278726 CCTTCTTGAGCAGGCTTTCCAGG - Intronic
1096132693 12:49173011-49173033 CCTTTGGGTGTTGGGTGTCCAGG - Intergenic
1096136937 12:49210414-49210436 AGTTTGTGTGCAGGATGCCCAGG + Intronic
1099914704 12:88877656-88877678 GATATGTGTGCAGGCTGTGCAGG - Intergenic
1099948821 12:89277021-89277043 ACTTTGGATGCAGGCTGTGCTGG + Intergenic
1100385559 12:94102034-94102056 CCTGGGTGTCCAGGGTGTCCAGG - Intergenic
1101762554 12:107670710-107670732 CCTTCGTTTGCAGGCTTTGCAGG - Intergenic
1104546895 12:129721283-129721305 CCTTGGTGGACAGGCAGTCCTGG - Intronic
1104717265 12:131024313-131024335 CCTCAGTGTGCTGGCTTTCCTGG + Intronic
1106012337 13:25837013-25837035 CCTTTGTTTGGAGGGTGTCTGGG + Intronic
1106050011 13:26180970-26180992 ACTTGGGGTGCTGGCTGTCCAGG + Intronic
1112004853 13:95245413-95245435 CCAGTGTGTGCAGGATTTCCTGG - Intronic
1113459690 13:110473093-110473115 CCTTTAAGCCCAGGCTGTCCAGG - Exonic
1114548114 14:23517161-23517183 GCTTTGTGTGAGGGCTGTCTGGG + Intergenic
1116147126 14:41088392-41088414 GCTATGTGTGCAGGATGTGCTGG + Intergenic
1118241028 14:64059297-64059319 CCTTCTTGGGCAGGCTTTCCAGG + Intronic
1120071860 14:80112512-80112534 CCTTTTTGTGAAGCCTTTCCTGG + Intergenic
1120656934 14:87201550-87201572 CCTTTGTGAGTAGCCTTTCCTGG - Intergenic
1120827188 14:88966673-88966695 GCTTTGTGAGCAGGCAGGCCTGG - Intergenic
1121117876 14:91356328-91356350 CCTCTGTGTGCAGCCTGCCGAGG + Intronic
1122564078 14:102639346-102639368 CATTTGTGTCCAGGAGGTCCAGG - Intronic
1123927684 15:25134349-25134371 CCTTTCTGTGCAGGCTTCCAGGG + Intergenic
1123947854 15:25247578-25247600 CCTGTGTGGGCATGGTGTCCGGG + Intergenic
1126230907 15:46323015-46323037 GCTATGTGTGCAAGCTGTCATGG + Intergenic
1127190983 15:56530151-56530173 CCCTTGTGTGCAGGCAGAACCGG - Intergenic
1129341861 15:74891468-74891490 CCTTTGAGCCCAAGCTGTCCTGG - Exonic
1129521239 15:76187538-76187560 CCTTTTTGTGCAGGATGACAGGG - Intronic
1130652401 15:85769522-85769544 CCTCCGGGTGCAGGTTGTCCTGG + Exonic
1130960581 15:88656274-88656296 CCTAGATGTGCAGGCAGTCCAGG - Exonic
1131372122 15:91891333-91891355 ACATTGGGTGCAGGCTGCCCTGG - Intronic
1132003288 15:98201775-98201797 CCTCTGTGTGCTGGGTGTCATGG - Intergenic
1132825034 16:1900410-1900432 CCTGTGTGTGCGTGCTGTGCAGG + Intergenic
1132914157 16:2333279-2333301 CCTTTGTGGACAGGCTTTCATGG - Intronic
1134444762 16:14322391-14322413 CCTGTGCGTGCAGCCTGCCCTGG + Intergenic
1135047156 16:19165358-19165380 CCTTGGAATGCAGGCTGTACAGG + Intronic
1136474935 16:30506931-30506953 CCCATGTGTTCAGGCTGTCCTGG - Intronic
1137431193 16:48419182-48419204 GCTTTGCCTGCAGGCTCTCCTGG - Intronic
1137527357 16:49247910-49247932 GCTTTGGGGCCAGGCTGTCCAGG + Intergenic
1137726894 16:50662786-50662808 CCTTTGAGTCCGGGCTGTCCTGG - Intergenic
1137912020 16:52387343-52387365 CCTTTCTTTACAGTCTGTCCGGG - Intergenic
1138111081 16:54324546-54324568 GCTTTTTGTGGAGGCTGGCCTGG - Intergenic
1140860480 16:79013588-79013610 CCTTGGTGAGTGGGCTGTCCCGG - Intronic
1140939647 16:79709339-79709361 CCTCCGTGGTCAGGCTGTCCTGG + Intergenic
1142191536 16:88720474-88720496 ACTTGGTGTGCAGGATGTCGTGG + Exonic
1142224494 16:88870984-88871006 CCTGGGTCTGCAGGCTGTGCAGG - Intergenic
1142765896 17:2064102-2064124 CCCTTGTGTTCAGGCTGCTCTGG - Intronic
1144689659 17:17252342-17252364 CTTTGGTGTGTGGGCTGTCCAGG + Intronic
1144689665 17:17252377-17252399 CTTTGGTGTGTGGGCTGTCCTGG + Intronic
1144689671 17:17252412-17252434 CTTTGGTGTGTGGGCTGTCCTGG + Intronic
1144689677 17:17252447-17252469 CTTTGGTGTGTGGGCTGTCCTGG + Intronic
1147026131 17:37585832-37585854 CCTTTGGGTCCAGGCTTTGCTGG + Intronic
1149566228 17:57642593-57642615 GATCTGTGTGCAGCCTGTCCTGG + Intronic
1150467284 17:65403992-65404014 ACTTTCTGTGCAAGCTGGCCAGG + Intergenic
1152571600 17:81123550-81123572 CCTTTATGTGCAGGCTCCACAGG - Intronic
1152918488 17:83053429-83053451 TCTCTGTGTGCAGGCAGCCCAGG - Intergenic
1153522921 18:5968971-5968993 CCTTGAGGTGCAGGATGTCCTGG + Intronic
1153648896 18:7221708-7221730 CCTTTGTGGGAAGGCTGGCCAGG + Intergenic
1154015451 18:10612404-10612426 CCTTTCTCTGGTGGCTGTCCAGG - Intergenic
1154190058 18:12223227-12223249 CCTTTCTCTGGTGGCTGTCCAGG + Intergenic
1154314894 18:13296891-13296913 GCTTTGAGGGCAGGCTGACCAGG + Intronic
1155522763 18:26685630-26685652 CCTTTGTTTGCAGACTGGCAGGG - Intergenic
1157323428 18:46651426-46651448 CCTTTATGTGCAAGCTGTGTGGG - Intronic
1157474167 18:48010876-48010898 CCTCTGTGCTGAGGCTGTCCTGG + Intergenic
1157937120 18:51884903-51884925 CCTTCTTGGGAAGGCTGTCCAGG - Intergenic
1160071314 18:75630847-75630869 CCTCAGTGTCCAGGCAGTCCCGG - Intergenic
1160082407 18:75740954-75740976 CCTTGGTGTACAGGCTTTCTGGG + Intergenic
1162131277 19:8527520-8527542 CCTCTGTGGCCAGGCTGGCCAGG - Intronic
1162562344 19:11423966-11423988 CCTTGGCATGCAGGCTGTCCTGG + Exonic
1163381989 19:16975249-16975271 CCTTTGCCTGCAGGTTTTCCAGG - Exonic
1163530189 19:17844240-17844262 CCTGTGCGTGCAGGCTGCCAAGG - Exonic
1164525772 19:29012498-29012520 CTTTTTTGTGCAGGCTGGTCTGG + Intergenic
1165429889 19:35766689-35766711 GGCGTGTGTGCAGGCTGTCCTGG + Intronic
1165638427 19:37363528-37363550 CCTTTGTGTGCAGGGAGTGTGGG + Exonic
1167584670 19:50367319-50367341 CCTTTTTGGGGAGGCTTTCCAGG + Intronic
925122046 2:1427161-1427183 CTTCTGTGTGCAGCCTGCCCTGG - Intronic
925775207 2:7328493-7328515 TCATGGTGTGCAGGCTGTACAGG - Intergenic
926284096 2:11473758-11473780 TCTTTGTGGACAGGCTGTCATGG - Intergenic
926993837 2:18712000-18712022 CCTTTGTTTGCAGCTGGTCCGGG + Intergenic
928458378 2:31446272-31446294 GCTTTGTGTGAAGGGTTTCCTGG + Intergenic
928938661 2:36705857-36705879 CTTTGTTGTGGAGGCTGTCCTGG + Intronic
931537665 2:63297259-63297281 CCTTGGAATGCAGGCTGTACCGG - Intronic
933990004 2:87627275-87627297 ACTTTGTGGGAAGGCTGGCCGGG - Intergenic
935032540 2:99336545-99336567 TCTTAGTGCGCAGGCTGTCGTGG + Intronic
935428069 2:102942286-102942308 CCTCTGGGGACAGGCTGTCCAGG - Intergenic
936303841 2:111323549-111323571 ACTTTGTGGGAAGGCTGGCCGGG + Intergenic
937318214 2:120945415-120945437 CCACTGTGGGCAGGATGTCCAGG + Intronic
939729613 2:145766039-145766061 CCTTTGAGTCCAAGATGTCCAGG - Intergenic
939829666 2:147056855-147056877 CTTTTGGGTCCAGGCAGTCCTGG + Intergenic
941742361 2:169048042-169048064 CCTTCTTGGGAAGGCTGTCCAGG - Intergenic
942084381 2:172429902-172429924 CCTGTGTGTGCTGGTTCTCCTGG - Intronic
944671126 2:201995460-201995482 CCTTGCTGTGCAGGATATCCTGG + Intergenic
947360939 2:229344702-229344724 GCTTTGTGTGCAGGGTGTGTGGG - Intergenic
948089059 2:235276721-235276743 CGTTTGTGTGCAGGTTGTTGTGG - Intergenic
948679172 2:239620773-239620795 CCTCTGTGTGCAGCCCCTCCCGG + Intergenic
948936186 2:241166501-241166523 CCAGTGTGTGCTGGCTGGCCAGG - Intronic
1170259377 20:14386727-14386749 CATGTGTCTGCAGGCTGTTCAGG - Intronic
1171143952 20:22765769-22765791 TCTTGGGGTGCTGGCTGTCCAGG + Intergenic
1171783650 20:29443887-29443909 CTTTTATGAGCAGGCTGCCCTGG - Intergenic
1174524829 20:51162605-51162627 GCTTGGTGTGCAGGCTGTGAGGG + Intergenic
1175068344 20:56309961-56309983 CCACTGTGTCCAGGGTGTCCTGG - Intergenic
1176042768 20:63073881-63073903 CCTGTGTGTCCAGCCTGTGCAGG - Intergenic
1176306030 21:5123600-5123622 ACTCTGGGTGCAGGCTGCCCAGG + Intronic
1176411147 21:6450259-6450281 CCTTTGTGTGCAGGCTGTCCTGG - Intergenic
1177379059 21:20314458-20314480 CCTTGGAATGCAGGCTGTACAGG + Intergenic
1179083394 21:38194379-38194401 CATGTTTATGCAGGCTGTCCAGG - Intronic
1179455714 21:41498467-41498489 TCTTTCTGGTCAGGCTGTCCTGG - Intronic
1179478654 21:41664065-41664087 CCTCTGTGTGCAGCCTCTCCTGG - Intergenic
1179646098 21:42777264-42777286 TCTGGGTGTGCAGGCTGACCAGG - Intergenic
1179686640 21:43058581-43058603 CCTTTGTGTGCAGGCTGTCCTGG - Intronic
1179851027 21:44138431-44138453 ACTCTGGGTGCAGGCTGCCCAGG - Intronic
1179960159 21:44763642-44763664 CCTGGGTGTGCTGGGTGTCCGGG - Intergenic
1179960165 21:44763660-44763682 CCTGGGTGTGCTGGGTGTCCTGG - Intergenic
1179960217 21:44763832-44763854 CCCGGGTGTGCAGGGTGTCCCGG - Intergenic
1179960229 21:44763868-44763890 CCTGGGTGTGCAGGGTGCCCCGG - Intergenic
1179960298 21:44764093-44764115 CCTGGGTGTGCAGGGTGCCCCGG - Intergenic
1179960338 21:44764231-44764253 CCTGGGTGTGCCGGGTGTCCCGG - Intergenic
1179960366 21:44764317-44764339 CCTGGGTGTGCCGGGTGTCCCGG - Intergenic
1179960395 21:44764404-44764426 CCCAGGTGTGCAGGGTGTCCTGG - Intergenic
1180091102 21:45534226-45534248 CCTCTGTGGGCAAGCTCTCCTGG + Intronic
1180350427 22:11796895-11796917 CCCTTGAGTGCAGGATGTCAAGG - Intergenic
1181009519 22:20032318-20032340 TGGTTGTGTGCAGGCTGCCCTGG + Intronic
1181266560 22:21634195-21634217 CCACTGTCTCCAGGCTGTCCAGG - Exonic
1182416793 22:30226504-30226526 CCTATGTGTCAAGGCTGTTCTGG - Intergenic
1182745718 22:32604112-32604134 CCTTTGGTGGGAGGCTGTCCGGG - Intronic
1182916360 22:34036184-34036206 TCTTTTTGTGCATGCTTTCCTGG + Intergenic
1182924808 22:34112083-34112105 CCTCTCTGTGCAGGCATTCCTGG + Intergenic
1183335466 22:37243728-37243750 CCTTTGTCCCCAGGCTGACCTGG - Intronic
950695487 3:14698414-14698436 CCTTTTTGGGAAGGCTTTCCAGG + Intronic
953272321 3:41457705-41457727 CCTTTGTGTGCATCTTGTACAGG + Intronic
953447557 3:42980632-42980654 CCTTTGTGTGCAGGGGGGCCTGG + Intronic
954395414 3:50290835-50290857 CCTGTGTGTGGGGTCTGTCCAGG + Intronic
954461562 3:50629794-50629816 CCTTTGTTTCCAGGTTGTCTGGG + Intronic
956227026 3:66972024-66972046 CCTATGCGTCCAGGCTGTCCTGG + Intergenic
957081821 3:75642661-75642683 CTTTTATGAGCAGGCTGCCCTGG + Intergenic
960849138 3:122034371-122034393 CATTTGTTTGCAGTTTGTCCAGG - Intergenic
963472370 3:145756645-145756667 CCTTTGTATACAGCCTGTTCAGG - Intergenic
965691405 3:171360785-171360807 CCTTTATATGAAGGCTTTCCTGG + Intronic
966731534 3:183155465-183155487 CCTTTGTGTTCTGGCTTTCATGG + Intronic
967007451 3:185397934-185397956 CCTTTATGTGCAGCCCTTCCAGG - Intronic
967944015 3:194787846-194787868 CCTGTGTGTGCAGGTTGCCAAGG - Intergenic
969696889 4:8740065-8740087 CCTATGAGTGCAGGCTGGGCAGG + Intergenic
973573442 4:52263022-52263044 ACTTGGAGTGCAGGCTTTCCTGG + Intergenic
974110602 4:57521090-57521112 CATGTGTCTGCAGGCTGTACAGG + Intergenic
974469788 4:62303316-62303338 CCTTCTTGTGAAGGCTTTCCAGG - Intergenic
976161346 4:82202291-82202313 CCTTTGTGAGAAGGCTTTCCAGG - Intergenic
978071101 4:104470944-104470966 CCTTTGTGTGTAGGTTGTGGGGG + Exonic
982772497 4:159410359-159410381 TGTTTGTGTGGAGGCTGTGCAGG - Intergenic
983975554 4:173929342-173929364 CCATTGTGAGCTGGCAGTCCAGG - Intergenic
985449049 4:190048314-190048336 CTTTTATGAGCAGGCTGCCCTGG - Intergenic
985770019 5:1803801-1803823 CTTCCGTGTGCAGGCTGTCCTGG + Intronic
985863594 5:2494082-2494104 CCCTTTTGTGCCTGCTGTCCTGG + Intergenic
986958906 5:13189944-13189966 CCTTTGTGTCCAGGCTGACGTGG + Intergenic
987898765 5:23983284-23983306 CCTTTCTGTGCAGCCTCTTCTGG + Intronic
990900093 5:60740151-60740173 CCTTTTTGGGAAGGCTTTCCAGG - Intergenic
991536420 5:67673818-67673840 CCTTTGTTTACAGGCAGTACTGG - Intergenic
992993307 5:82307520-82307542 CCTCTTTGGGCAGGCTGTCCAGG - Intronic
995347315 5:111135449-111135471 CCTCTTTGTGCAGCCTGCCCTGG - Intergenic
995645985 5:114312245-114312267 GCTTTTTGAACAGGCTGTCCAGG + Intergenic
995841494 5:116447065-116447087 CTTTGGGGGGCAGGCTGTCCAGG + Exonic
997197295 5:131988613-131988635 CCTTCGTGTGAAGTCTGACCAGG + Intronic
998137992 5:139684531-139684553 CCTTCCTGTTCAGGCTGCCCTGG - Intergenic
1005694120 6:28335676-28335698 GCTTAGTCTGCGGGCTGTCCTGG - Intronic
1006986824 6:38181003-38181025 CATTTGTGTACATCCTGTCCAGG - Intronic
1008085792 6:47242656-47242678 CGGGTGTCTGCAGGCTGTCCAGG + Intronic
1008848391 6:55995605-55995627 CCTTCTTGGGCAGGCTTTCCAGG + Intergenic
1009041755 6:58188707-58188729 CCTTTGTGTTTAGTCTGTTCTGG + Intergenic
1009217605 6:60942970-60942992 CCTTTGTGTTTAGTCTGTTCTGG + Intergenic
1010062027 6:71634785-71634807 CCTTTTTGGGAAGGCTTTCCAGG + Intergenic
1012423875 6:99093611-99093633 CCTTTGTTTGCAGGCACCCCTGG + Intergenic
1013263122 6:108466571-108466593 CCTCTGTGTGCACGCACTCCTGG - Intronic
1015277380 6:131398350-131398372 TCTTTGTGTGCAGGGGGTCAGGG + Intergenic
1015578683 6:134700853-134700875 CCTTTTTGGGAAGGCTTTCCAGG + Intergenic
1018254415 6:161904119-161904141 CCTTTGTGCCCAGGTTGTCTTGG + Intronic
1018939574 6:168300171-168300193 CCTTTGTGTGAGGGCTGCACTGG - Intronic
1023093455 7:36637597-36637619 CTTTGTTGTGCAGGCTGTCCTGG - Intronic
1023495268 7:40788238-40788260 CCTTTGACTGCATGCTGGCCGGG - Intronic
1024090518 7:45936058-45936080 TCTATTTGTGCAGGCTGTCAGGG + Intergenic
1024268622 7:47625683-47625705 CCTTTGTCTCCAGGCTGAGCTGG + Intergenic
1024334915 7:48197235-48197257 CCTTTGTGTTCTGGCTTTCAGGG + Intronic
1029381002 7:100214487-100214509 GCTTTGTCTACAGGCTCTCCAGG + Intronic
1029400380 7:100341434-100341456 GCTTTGTCTACAGGCTCTCCAGG + Intronic
1029473976 7:100771968-100771990 CCTGTGTGCCCAGGCTGGCCAGG + Exonic
1029846926 7:103421409-103421431 CCTTTGTGTGTAGTCTTTCCTGG + Exonic
1030638799 7:111980607-111980629 CCTTGTTGTGGGGGCTGTCCTGG + Intronic
1031098619 7:117449717-117449739 CCTTCTTGTGAAGGCTTTCCAGG - Intergenic
1033287584 7:140055873-140055895 CTTTTGTTTGCAGGTAGTCCTGG + Intronic
1034518960 7:151604109-151604131 CCTGTGTGTGAAGGCAGTGCTGG - Intronic
1035008803 7:155692538-155692560 CCTATGTGTGCAGGGTCACCTGG + Intronic
1035126863 7:156614705-156614727 CCTTTATGTGCACGGAGTCCCGG + Intergenic
1037911744 8:22747819-22747841 CCTCTGTGGGAAGGCTTTCCGGG - Intronic
1037936613 8:22919239-22919261 CCTTTCTGTGCAGGGTGGCAGGG - Intronic
1038480018 8:27895396-27895418 ACTTTCTGATCAGGCTGTCCTGG + Intronic
1039133244 8:34291777-34291799 CCTTTGGCTCCAGGCTGTCTGGG + Intergenic
1039422143 8:37452140-37452162 CCTTTGCTTGCACGCTGACCCGG - Intergenic
1041533700 8:58901858-58901880 CCTTTTTGTAAAGTCTGTCCAGG - Intronic
1045056710 8:98374580-98374602 CCTTTGGGTGCAGTCAGTCCTGG + Intergenic
1045363842 8:101457260-101457282 CCTTTGAGCCCAGGATGTCCAGG + Intergenic
1046928721 8:119822122-119822144 CCTTTGTGTTCATGCTATACAGG + Intronic
1047411324 8:124626960-124626982 CCCCTGTGTGCAGGCTGGGCAGG - Intronic
1048845666 8:138602122-138602144 CCTTTGAATCCAGGCTCTCCAGG + Exonic
1050597078 9:7214809-7214831 CCTTAGTGTTCAGGCTGGCTTGG - Intergenic
1051516174 9:17932695-17932717 CCCTTTAGTGCAGGCTATCCTGG + Intergenic
1051559494 9:18424521-18424543 TCATTCTGTGCAGGCTATCCTGG - Intergenic
1052573654 9:30264029-30264051 CCTTCTTGTGAAGGCTTTCCAGG + Intergenic
1054810307 9:69429040-69429062 CCGTTATGTGCAGGTTGTACAGG + Exonic
1054956329 9:70914958-70914980 CCTTTTTGGGAAGGCTTTCCAGG - Intronic
1056904295 9:90632051-90632073 CCATTGTTAGCAGGCTCTCCAGG + Intronic
1057967446 9:99517894-99517916 CCTTTGTGTTCTGGCAATCCTGG - Intergenic
1062114115 9:134798432-134798454 CCTCTCTGTCCAGGGTGTCCTGG - Exonic
1062512056 9:136911726-136911748 CATGTATGTGCAGGGTGTCCTGG + Intronic
1062656614 9:137606970-137606992 CCTGGGTGTGCAGGCTCCCCTGG + Intronic
1203444287 Un_GL000219v1:40844-40866 CTTTTATGAGCAGGCTGCCCTGG - Intergenic
1185513470 X:680417-680439 TGTGTGTGTGCAGGCTCTCCTGG + Intergenic
1186695893 X:12031666-12031688 CCTTGTTGTGGAAGCTGTCCTGG - Intergenic
1189284957 X:39845565-39845587 CCTGGGTCTGCAGGCTCTCCTGG - Intergenic
1191946822 X:66543695-66543717 CCTTCGTGGGTAGGCTTTCCAGG + Intergenic
1193712438 X:84895211-84895233 GCTTAGTTTGCAGGCTGTCTTGG + Intergenic
1200105506 X:153709911-153709933 GCTGCGTGTGCAGGCTGCCCTGG + Intronic
1202097476 Y:21266905-21266927 GCTTAGTCTGCAAGCTGTCCTGG + Intergenic
1202242271 Y:22783563-22783585 CCTTTTTGCCCAGGCTGGCCTGG - Intergenic
1202395255 Y:24417311-24417333 CCTTTTTGCCCAGGCTGGCCTGG - Intergenic
1202475530 Y:25252783-25252805 CCTTTTTGCCCAGGCTGGCCTGG + Intergenic