ID: 1179686772

View in Genome Browser
Species Human (GRCh38)
Location 21:43059108-43059130
Sequence CAGTGTGACAGGCAGGAGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 593
Summary {0: 4, 1: 1, 2: 8, 3: 46, 4: 534}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179686772_1179686779 -6 Left 1179686772 21:43059108-43059130 CCGCTCTCCTGCCTGTCACACTG 0: 4
1: 1
2: 8
3: 46
4: 534
Right 1179686779 21:43059125-43059147 ACACTGGGCAGGGCCAGCACAGG 0: 6
1: 0
2: 3
3: 31
4: 317
1179686772_1179686786 28 Left 1179686772 21:43059108-43059130 CCGCTCTCCTGCCTGTCACACTG 0: 4
1: 1
2: 8
3: 46
4: 534
Right 1179686786 21:43059159-43059181 TGCTCTCCTGCCTGTCACACTGG 0: 2
1: 4
2: 2
3: 37
4: 357
1179686772_1179686787 29 Left 1179686772 21:43059108-43059130 CCGCTCTCCTGCCTGTCACACTG 0: 4
1: 1
2: 8
3: 46
4: 534
Right 1179686787 21:43059160-43059182 GCTCTCCTGCCTGTCACACTGGG 0: 6
1: 0
2: 3
3: 26
4: 253
1179686772_1179686782 2 Left 1179686772 21:43059108-43059130 CCGCTCTCCTGCCTGTCACACTG 0: 4
1: 1
2: 8
3: 46
4: 534
Right 1179686782 21:43059133-43059155 CAGGGCCAGCACAGGCCACGGGG 0: 4
1: 0
2: 3
3: 54
4: 444
1179686772_1179686783 3 Left 1179686772 21:43059108-43059130 CCGCTCTCCTGCCTGTCACACTG 0: 4
1: 1
2: 8
3: 46
4: 534
Right 1179686783 21:43059134-43059156 AGGGCCAGCACAGGCCACGGGGG 0: 2
1: 0
2: 3
3: 27
4: 298
1179686772_1179686780 0 Left 1179686772 21:43059108-43059130 CCGCTCTCCTGCCTGTCACACTG 0: 4
1: 1
2: 8
3: 46
4: 534
Right 1179686780 21:43059131-43059153 GGCAGGGCCAGCACAGGCCACGG 0: 4
1: 0
2: 7
3: 111
4: 795
1179686772_1179686781 1 Left 1179686772 21:43059108-43059130 CCGCTCTCCTGCCTGTCACACTG 0: 4
1: 1
2: 8
3: 46
4: 534
Right 1179686781 21:43059132-43059154 GCAGGGCCAGCACAGGCCACGGG 0: 4
1: 0
2: 4
3: 66
4: 508

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179686772 Original CRISPR CAGTGTGACAGGCAGGAGAG CGG (reversed) Intronic
900180669 1:1309648-1309670 CAGGGTGACCGTCAGGAGGGTGG - Intronic
900384400 1:2402977-2402999 CAGTGTGACTGACTGGAGAGCGG + Intronic
900428056 1:2589407-2589429 CAGTGTGACAGAGAGGTGTGAGG + Exonic
900711878 1:4119590-4119612 CAGGGAGACAGGCAGGAGGAGGG + Intergenic
901641780 1:10696261-10696283 CTGTGTGACGGCCAGGAGTGGGG - Intronic
902413509 1:16225828-16225850 CAGGGTCACAGGCAGCAGACAGG + Intergenic
902622572 1:17659080-17659102 CAGTGTGTCAGGGAGTAGAGAGG + Intronic
902717564 1:18283121-18283143 GAGAGTGGCAGGGAGGAGAGCGG - Intronic
902883448 1:19388068-19388090 CAGTGTGCCTGGCAGGAGAAGGG - Intronic
903325513 1:22566679-22566701 CAGCGCAAGAGGCAGGAGAGAGG + Intronic
903596482 1:24499458-24499480 CACTGTGGCAGGCAACAGAGGGG + Intergenic
903798128 1:25945803-25945825 CAGTGCTCCAGGTAGGAGAGAGG + Intergenic
904298309 1:29538206-29538228 CAGTGGGACAGGGAAGAGAGAGG - Intergenic
904631658 1:31847348-31847370 CAGAGTGGCAGGGAGGAGGGAGG + Intergenic
905037015 1:34925131-34925153 CAGTGGGAGGGGCAGGGGAGAGG - Intronic
905267622 1:36765594-36765616 CAGTGTGGCTGGCAGTAGCGGGG + Intergenic
905562869 1:38941378-38941400 CAGTGTGAAGGGCAGGGAAGAGG + Intronic
906267060 1:44440360-44440382 CAGTGTGCAAGGGTGGAGAGTGG + Intronic
907186342 1:52612264-52612286 CAGTGTCACATGCAGCTGAGAGG - Intergenic
907747055 1:57223859-57223881 CAAGGTGTCAGGAAGGAGAGAGG - Intronic
908650559 1:66328624-66328646 CAGGGAGACAGGCAGGTGACAGG - Intronic
909488571 1:76201295-76201317 CATGGTGGCAGGCAAGAGAGAGG + Intronic
909764196 1:79334322-79334344 CTGTGTGACTGGGAGGAGACTGG + Intergenic
910559788 1:88577997-88578019 CATTATGACAGGAAGCAGAGTGG + Intergenic
911084897 1:93968194-93968216 CAGTCTGCCAGGCAGAAGTGTGG - Intergenic
911248642 1:95549251-95549273 GAGTGTGACAGACAGCAGAATGG - Intergenic
911323432 1:96441499-96441521 CAGTGTAAAATGCAGCAGAGAGG - Intergenic
912372634 1:109185731-109185753 CTGTATGAGAGGCTGGAGAGAGG + Intronic
912775412 1:112503686-112503708 CAGGGAGACAGGCAAGAGACAGG + Intronic
914929749 1:151920597-151920619 CAGTTTGCAAGCCAGGAGAGAGG - Intergenic
915275196 1:154783686-154783708 CTGTGGGACTGGAAGGAGAGGGG + Intronic
915526859 1:156481246-156481268 CAAAGTGACAGGCAGGGAAGGGG + Intronic
915530197 1:156498870-156498892 CAGTGTGTTGGGCAGGAGATGGG - Intronic
915972293 1:160363279-160363301 CAGTGGGTTTGGCAGGAGAGGGG - Intergenic
916213254 1:162375082-162375104 CAGTTTCAGAGACAGGAGAGGGG + Intronic
917472880 1:175340954-175340976 GAGTGCGATAGGAAGGAGAGGGG + Intronic
917605533 1:176624892-176624914 CAGGAGGGCAGGCAGGAGAGTGG + Intronic
918128515 1:181604931-181604953 CAGTGTGGGAGACATGAGAGAGG + Intronic
918531373 1:185525694-185525716 CAGTGTGGGAGCCAGGAGAATGG + Intergenic
919603031 1:199646732-199646754 GAGTGTGAGAGGCAGGAGAAAGG - Intergenic
920039613 1:203086851-203086873 GAGTGAGACAGGGAGGAGACAGG - Intergenic
920256789 1:204660901-204660923 CAGAGGGACTGGCAGGGGAGTGG + Intronic
922062528 1:222105955-222105977 CAGTGGGACTGGAAGCAGAGAGG - Intergenic
922552335 1:226505009-226505031 CAGAGGGAAAGGAAGGAGAGAGG + Intergenic
922994917 1:229948438-229948460 GAGTGAGACAGGACGGAGAGTGG - Intergenic
924717233 1:246587807-246587829 CATTGTGAAAGGCAGGATTGAGG + Intronic
924865906 1:247979663-247979685 CATTGGGACAGGCTGGACAGTGG - Intronic
1063906843 10:10788913-10788935 GGGTGTGGCAAGCAGGAGAGAGG - Intergenic
1064008264 10:11714952-11714974 CAGTGAGAAGGGCAGGAGAGGGG + Intergenic
1064336719 10:14450132-14450154 CATACTGCCAGGCAGGAGAGTGG - Intronic
1064436844 10:15318171-15318193 AAATGTGACCAGCAGGAGAGGGG + Intronic
1064833687 10:19501025-19501047 GAGTGTGACAGCCAGTAGATAGG + Intronic
1065163464 10:22948496-22948518 CATTGTTACAGGCAGTAGAGTGG - Intronic
1066255169 10:33671526-33671548 CTGTGTGTCAGGCAGGTGACAGG - Intergenic
1066292564 10:34027544-34027566 CACTGTGCCAGGCATGAGTGTGG + Intergenic
1067039758 10:42943009-42943031 CTGTGTTCCAGGCAGGAGAAAGG + Intergenic
1067251098 10:44587697-44587719 CAGTGTGCCAGTCCTGAGAGGGG - Intergenic
1067734893 10:48842807-48842829 GAGTGTGACTGGCAGGAGATAGG - Intronic
1067739857 10:48887211-48887233 TGGTGTCACAGGGAGGAGAGAGG + Intronic
1068320594 10:55409147-55409169 AAGTGTGAAATTCAGGAGAGAGG - Intronic
1069397767 10:68008498-68008520 TAGTTTGGCAGGCAGGAGAATGG + Intronic
1069903647 10:71719941-71719963 CAAGGAGACAGGCTGGAGAGAGG - Intronic
1070135958 10:73693739-73693761 CAGTGAAAGAGGGAGGAGAGAGG - Intronic
1070540283 10:77410664-77410686 CAGGATGACAGGCACGAGTGGGG - Intronic
1070747925 10:78946043-78946065 CAGTGAGAGAAGCAGGATAGGGG - Intergenic
1071293864 10:84205382-84205404 GAGTGGGACAGGCAGGAGATGGG - Intronic
1071494050 10:86155677-86155699 CAGTGAAAAAGGCAGGGGAGTGG - Intronic
1071532247 10:86399642-86399664 TACTATGAAAGGCAGGAGAGTGG + Intergenic
1073771300 10:106738543-106738565 CAGTGTGAGAGGAAGGAGGCTGG + Intronic
1073803719 10:107072127-107072149 CAGGGTAACAGGAAGGAGACAGG + Intronic
1074869045 10:117562688-117562710 CAGGGTGGCAGCCAGGAGAGGGG + Intergenic
1074884783 10:117685156-117685178 CAGCCTGGCAGGCAGGAGTGAGG - Intergenic
1075894343 10:125981761-125981783 CAGTGTCACAGTCAGGATATTGG + Intronic
1076065587 10:127445245-127445267 CTGTGCCACAGGAAGGAGAGTGG - Intronic
1076066812 10:127455268-127455290 CAGTGTCACTAGCTGGAGAGGGG + Intergenic
1076423693 10:130352158-130352180 CAGTGTCCCAGGCAGGAGCCTGG + Intergenic
1076866510 10:133168933-133168955 CTGTGTGGCCGGCTGGAGAGGGG + Intronic
1077396405 11:2325469-2325491 CAGTGTGACATGCCGGGGAAGGG - Intergenic
1077437661 11:2550551-2550573 CAGAGTGCCAGGCAGGGTAGGGG + Intronic
1077529566 11:3088826-3088848 GCGTCTGCCAGGCAGGAGAGAGG + Intronic
1077899655 11:6478442-6478464 TAGTGTGGCAAGCAGGGGAGGGG + Intronic
1077977340 11:7261711-7261733 GAGCGTTCCAGGCAGGAGAGCGG + Intronic
1077982890 11:7319115-7319137 CAATGAGAAAGGGAGGAGAGTGG + Intronic
1078090673 11:8262804-8262826 CAGGGTGCCCGGCAGGCGAGGGG - Intronic
1078662239 11:13296916-13296938 CACTGTCACAGGCAGGAGGACGG - Intronic
1079289920 11:19178785-19178807 AAGTGTGAGAGGAAGGAGAAGGG + Intergenic
1080943350 11:36944013-36944035 GTGTGTGAAAGGAAGGAGAGGGG + Intergenic
1081561185 11:44218457-44218479 TAATGTGACAGGCAGAAAAGAGG + Intronic
1081967566 11:47178875-47178897 CAGGGTGAGAGCCAGGAGCGCGG - Exonic
1083595841 11:63917905-63917927 CAGAGTGACAGACAGGGAAGCGG + Intergenic
1083995453 11:66269344-66269366 CAGTGTGACAGCCAAGGGAAGGG - Intronic
1084169855 11:67395855-67395877 CAGAGTGGCAGGTGGGAGAGGGG + Intronic
1084285398 11:68127944-68127966 CAGGGGCACAGGCAGGACAGCGG + Intergenic
1084955552 11:72689413-72689435 CAGAGTGAATGGCAGGGGAGGGG + Intronic
1085079700 11:73624148-73624170 CAGTGTGATAGGCAGGGGAGGGG + Intergenic
1085203689 11:74717610-74717632 CAGTGTCAAAGTCAGGAGGGGGG + Intronic
1086025759 11:82289152-82289174 CAGTGTCATGGGCGGGAGAGAGG + Intergenic
1087265138 11:96052462-96052484 GAGTGTGACAAAGAGGAGAGTGG - Intronic
1087765371 11:102146361-102146383 GTGTCTCACAGGCAGGAGAGAGG - Intronic
1088083103 11:105944386-105944408 CTGTGAGACATGAAGGAGAGTGG - Intronic
1088086056 11:105981863-105981885 CAGTCTCACAGGCAGGGGGGTGG - Exonic
1088332205 11:108665503-108665525 CAGTGTGGCAAGCAGAAGAGTGG - Intronic
1088422177 11:109660386-109660408 CAGAATGATAGGCAGGAGAGGGG + Intergenic
1088469190 11:110175987-110176009 CAGTGGGAGAGGCGGGAGTGGGG + Intronic
1088557861 11:111080938-111080960 CATTTTGACAGCCAGGAGTGGGG - Intergenic
1088596494 11:111444877-111444899 CTCTGTGAGAGGCAGGGGAGTGG + Intronic
1088780221 11:113127002-113127024 CACTGTGGTAGGCAGGAAAGAGG - Intronic
1088885155 11:114000400-114000422 CAGTCTTACAGGAATGAGAGTGG + Intergenic
1088962641 11:114684826-114684848 CAGTGTGACAGGAAGTTGAATGG + Intronic
1089151345 11:116366770-116366792 CAGGGAGGCAGGCAGGTGAGAGG - Intergenic
1089306937 11:117532364-117532386 CTCTGTGACAGGTAGGGGAGAGG - Exonic
1089388808 11:118086089-118086111 CAATGTGAAGGGCAGGAGTGAGG - Intronic
1090260055 11:125312970-125312992 CCGTGTGAAAGGCAGGGGGGAGG + Intronic
1090527920 11:127557266-127557288 CAGTGTGTGAGGAAGTAGAGGGG + Intergenic
1090832205 11:130427748-130427770 GAGGGTCAGAGGCAGGAGAGAGG - Exonic
1091090332 11:132764947-132764969 CAGTGTCAGAGGCAGGCGTGAGG - Intronic
1091250667 11:134141438-134141460 CAGGGAGAGAGGGAGGAGAGGGG + Intronic
1091319497 11:134639887-134639909 CAGTGTGCCTGGCAGGGTAGAGG + Intergenic
1091820337 12:3471211-3471233 CACTGTGGCGGGAAGGAGAGGGG + Intronic
1092285638 12:7127945-7127967 CAGTGTCACAGGCTGGAGGGTGG + Intronic
1092793983 12:12092567-12092589 GAGAGGGACAGGCAGGGGAGGGG + Intronic
1093207975 12:16273394-16273416 GAGTGTGAGTGGAAGGAGAGGGG + Intronic
1093293961 12:17364832-17364854 CAGGGTGGCAGGGAGGAAAGGGG + Intergenic
1094025591 12:25958068-25958090 CAATGACAGAGGCAGGAGAGGGG - Intergenic
1094390125 12:29939953-29939975 CAGTGAGACAGCCAGGTGGGAGG - Intergenic
1094772192 12:33676012-33676034 AAGTGTGACAGGCAGAGGAAAGG - Intergenic
1095397828 12:41780839-41780861 CAATATCACAGGAAGGAGAGGGG + Intergenic
1095681155 12:44977636-44977658 GAGGGTGACTGGGAGGAGAGAGG - Intergenic
1096385607 12:51193023-51193045 CTGTGACACAGGCAGGCGAGAGG + Intronic
1096589693 12:52649359-52649381 CAGTGTCTCAAGCAGGAGAGAGG - Intronic
1096628802 12:52912241-52912263 CAGTGGGGAAGGCAGCAGAGGGG + Intronic
1097113416 12:56679709-56679731 CGGAGTGACAGGCTGGAGAACGG + Intronic
1097298188 12:57989753-57989775 CAGTGTAACAGGCAGGAAGATGG + Intergenic
1098226033 12:68325928-68325950 GAGTCTGGCAGGCAGGAGAAGGG - Intronic
1099815228 12:87638294-87638316 AAGTGTGACAAGCATGTGAGAGG + Intergenic
1101093640 12:101313726-101313748 GAGTGGGACAGGAAGGAGGGAGG + Intronic
1101760131 12:107651546-107651568 CAGTGTCACAGGTAGGGGACGGG - Intronic
1102042200 12:109808249-109808271 CAGTGGGACAGCCAGGGGTGTGG - Intronic
1102233455 12:111279321-111279343 CTGTGAGACAGGCAGGACCGAGG - Intronic
1102892162 12:116568350-116568372 CAGAGAGACAGGAAGAAGAGTGG - Intergenic
1103489302 12:121304522-121304544 CTGTTTTACAGGCAGGAAAGCGG - Intergenic
1103846895 12:123908102-123908124 CAGAGAGACAGGGAGGAGACAGG - Intronic
1103846906 12:123908159-123908181 CAGAGAGACAGGGAGGAGACAGG - Intronic
1103846921 12:123908227-123908249 CAGAGAGACAGGGAGGAGACAGG - Intronic
1104185026 12:126422330-126422352 CAGAGTGGGAGGCAGGAGAGGGG + Intergenic
1105765339 13:23553640-23553662 CAGTGTTAAAGGCAAGAAAGGGG + Intergenic
1106135046 13:26967613-26967635 CAGGGTCCCAGGCAGGAGACAGG - Intergenic
1106454693 13:29916896-29916918 CAGTGTGACAGGAAGAATAATGG + Intergenic
1107479883 13:40777343-40777365 AAGTTTGGCAGGTAGGAGAGGGG - Intergenic
1107975441 13:45683894-45683916 CAGTGTGTCTGGAAGCAGAGAGG - Intergenic
1108452310 13:50579564-50579586 CTGCGTTACAGACAGGAGAGAGG + Intronic
1108594588 13:51938349-51938371 GAATGTGACAGGCAGGTGTGGGG - Intronic
1108622884 13:52201253-52201275 CAGTTTGACAGGTAGGAGAGGGG - Intergenic
1108663846 13:52609789-52609811 CAGTTTGACAGGTAGGAGAGGGG + Intergenic
1109012482 13:56969842-56969864 CAGTGAGACAGACAGGTGGGAGG + Intergenic
1110909606 13:80939902-80939924 CAGTGGGCCAGGCAGGTGGGTGG + Intergenic
1112160013 13:96857208-96857230 CAAGGTGACAGGCAGGAAGGAGG - Intergenic
1112223697 13:97516329-97516351 CAATATCAAAGGCAGGAGAGAGG - Intergenic
1112386779 13:98946991-98947013 AAGTGAGACAGGCATGAAAGGGG - Intronic
1112441428 13:99427121-99427143 CAGGGTGGGAGGGAGGAGAGAGG + Intergenic
1112578696 13:100659974-100659996 CAGTGTGAAATGCTGGAGAGTGG + Intronic
1112712331 13:102143844-102143866 AGGTGTGACAGCCAAGAGAGAGG - Intronic
1112916174 13:104553270-104553292 TAGAGTCACAGACAGGAGAGTGG - Intergenic
1114412888 14:22517418-22517440 AAGTGTCAGAGGCAGGGGAGAGG + Intergenic
1114601495 14:23959120-23959142 CAGTGTGAAAGGAAGAGGAGGGG + Intronic
1114605677 14:23994250-23994272 CAGTGTGAAAGGAAGAGGAGGGG + Intronic
1114611185 14:24041889-24041911 CAGTGTGAAAGGAAGAGGAGGGG + Intergenic
1115423452 14:33225050-33225072 CAGTTAGAAAGGCAGGAAAGTGG - Intronic
1116897326 14:50329649-50329671 CAATCTGAGAGGCAGGAGATAGG + Exonic
1118318519 14:64739845-64739867 CAGTGTGATGGGAATGAGAGGGG - Intronic
1119215881 14:72868715-72868737 CAGAATGACAGGAAGGAGCGAGG + Intronic
1119590659 14:75884508-75884530 CTTTGTGACAGGCAAGAGTGTGG + Intronic
1121047050 14:90795966-90795988 CAGGGAACCAGGCAGGAGAGGGG + Intronic
1121236172 14:92392694-92392716 CAGTGTGACAGTGTTGAGAGTGG + Intronic
1121518805 14:94571592-94571614 CAGGGGAACAGGCCGGAGAGCGG + Intronic
1121729720 14:96178062-96178084 CAGAGAAACAGGCAGGGGAGGGG + Intergenic
1121971030 14:98355994-98356016 CCCTGTGATAGGCAGAAGAGTGG - Intergenic
1122114043 14:99518830-99518852 CAGTGAGGCGGGCAGGAGAGGGG - Intronic
1122121420 14:99555466-99555488 CTGTGTGCCAGGGAGGAGAAGGG - Intronic
1122288403 14:100666492-100666514 CAGTGGGAAGGGCTGGAGAGTGG - Intergenic
1122876507 14:104668638-104668660 CACTGTCACAGGGAGGAAAGTGG + Intergenic
1123033270 14:105461117-105461139 CAGTGTGACAGGAAGGACTATGG - Intronic
1123662571 15:22577269-22577291 CAGTGTGACTGGCAGCAGAAAGG + Intergenic
1124261712 15:28198642-28198664 CAGTGTGACTGGCAGCAGAAAGG - Exonic
1124316373 15:28671570-28671592 CAGTGTGACTGGCAGCAGAAAGG + Intergenic
1124327582 15:28781207-28781229 CAGTGTGACGGCCAAGAGAAGGG + Intergenic
1124368181 15:29088672-29088694 CAGAGGGGCAGGCAGCAGAGAGG - Intronic
1125106057 15:35972713-35972735 TAGTCGGAAAGGCAGGAGAGTGG + Intergenic
1126132256 15:45353178-45353200 CAGTGAGACAGGCTGGAGGTGGG + Intergenic
1127494128 15:59493622-59493644 CTGTCTGCCAGGCTGGAGAGCGG + Intronic
1127963379 15:63906646-63906668 AAGTGAGCCAGGAAGGAGAGAGG - Intergenic
1128054927 15:64692304-64692326 CACAGTTACAGGCTGGAGAGGGG + Intronic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1128942511 15:71800182-71800204 CAGGGTGACATGGAGGAGTGAGG - Intronic
1129877824 15:78988327-78988349 CAGTGGGACAGGGAAGGGAGGGG + Intronic
1131100733 15:89688112-89688134 CATTATGACAGGAAGCAGAGTGG - Intronic
1131349124 15:91680670-91680692 TAGTGATTCAGGCAGGAGAGAGG - Intergenic
1132861961 16:2076247-2076269 CAGAGTGACAGGCAGGTGGAGGG + Intronic
1133733637 16:8597170-8597192 CAGTGTGAAAGGGAATAGAGTGG + Intergenic
1133744513 16:8676077-8676099 CAGGTTGGGAGGCAGGAGAGAGG + Intronic
1134669662 16:16045477-16045499 CAGAGAGCCAGGTAGGAGAGAGG - Intronic
1135037979 16:19094262-19094284 CAGTGTGACTGTCAGCAGAGAGG + Intergenic
1135630697 16:24033887-24033909 CAGAGAGACACGGAGGAGAGAGG + Intronic
1136083646 16:27869055-27869077 GAGTGCGACAGCCAGGAGATGGG + Intronic
1136509118 16:30724913-30724935 CATGGTGACAGGCAAGGGAGCGG - Exonic
1137529222 16:49266540-49266562 CAGTGTGTCTTGCAGGAGAAAGG - Intergenic
1137669238 16:50269727-50269749 CAGTGGGAGAGGTAGGAGAGAGG - Intronic
1137831126 16:51544370-51544392 CAGAGAGAGAGGCAGAAGAGTGG + Intergenic
1138120586 16:54397983-54398005 AAGTGCAACAGGTAGGAGAGAGG + Intergenic
1138518655 16:57556601-57556623 TAGCACGACAGGCAGGAGAGAGG - Intronic
1138565113 16:57827508-57827530 CTGAGGGACAGGCAGGAGAAGGG - Intronic
1138583071 16:57954189-57954211 AAGTGTGGCATACAGGAGAGTGG - Intronic
1139908460 16:70381927-70381949 CGGGATGACAGGGAGGAGAGGGG + Intronic
1140268316 16:73439884-73439906 CAGTGGGGCAGGAAGGGGAGAGG + Intergenic
1140283500 16:73577551-73577573 CTGAGGGACAGGCAGGTGAGCGG - Intergenic
1140540822 16:75754970-75754992 CCATGTGCAAGGCAGGAGAGAGG + Intronic
1140681271 16:77387246-77387268 CAGTGTGGCAGGAAGAAAAGTGG + Intronic
1141196195 16:81863233-81863255 CAGAGAGACAGACAGTAGAGTGG - Intronic
1142020141 16:87777163-87777185 CAGAGTGTCTGGCAGCAGAGAGG - Intergenic
1142174998 16:88641040-88641062 CAGGGGGCCAGGCAGGGGAGGGG - Intergenic
1142220782 16:88853940-88853962 CAGTGTGACCAGTTGGAGAGTGG + Intronic
1142284373 16:89165743-89165765 CACTGTGACAGGAGGGAGGGAGG - Intergenic
1142501567 17:336021-336043 CAGGGCGACAGGGAGGAGATGGG + Intronic
1142637195 17:1265208-1265230 CAGTGTTACAGGCAGGGCTGGGG + Intergenic
1142850137 17:2700824-2700846 CCCTGTGGCAGGCAGGGGAGGGG + Exonic
1143272037 17:5683049-5683071 CAGAGGGACAGGAGGGAGAGGGG - Intergenic
1143591436 17:7887754-7887776 CAGGGAGGCAGGGAGGAGAGAGG - Intronic
1144149051 17:12425745-12425767 CACTATGCCTGGCAGGAGAGTGG - Intergenic
1144209731 17:13003918-13003940 CTGTGAGAGAGGAAGGAGAGAGG - Intronic
1144943942 17:18960331-18960353 GAGGGTGTCAGGCAGGGGAGTGG - Intronic
1144952335 17:19000956-19000978 CAGAGTGACAGGCAGGGGCTGGG - Intronic
1145017944 17:19411215-19411237 AAATGTGACAGTCAGGAAAGAGG - Exonic
1146460279 17:33040840-33040862 AAGTGTGAGAGACAGGAGTGGGG + Intronic
1146611356 17:34307887-34307909 CTGTAGGACAGGCAGGATAGTGG - Intergenic
1146686037 17:34842217-34842239 CAGGGTGTCAGGAGGGAGAGTGG - Intergenic
1146695998 17:34909554-34909576 CAGAGTGACAGCCAGGAGAAAGG + Intergenic
1147178350 17:38670483-38670505 CCTTGTGACAGACAGGAGAGGGG + Intergenic
1147338709 17:39741414-39741436 GAGTCAGAAAGGCAGGAGAGCGG - Intronic
1148131545 17:45265276-45265298 CAAGGTGATAGTCAGGAGAGCGG + Intronic
1148217904 17:45843783-45843805 CAGAGTTGCAGCCAGGAGAGTGG + Intergenic
1148406983 17:47424106-47424128 CAGCGTGGCTGCCAGGAGAGCGG + Intronic
1148547138 17:48527351-48527373 CAGTGTGCCGGGCGGGGGAGGGG - Intergenic
1148732740 17:49847323-49847345 CAGATTGTCAGGCAGGAGTGGGG + Intronic
1148897207 17:50845880-50845902 CTGGGAGGCAGGCAGGAGAGGGG - Intergenic
1148942924 17:51230717-51230739 CAGTGTGAAAGGTATGGGAGAGG + Intronic
1149386862 17:56151002-56151024 CAGAGTGAGAGGCAGGATGGAGG + Intronic
1149407871 17:56373070-56373092 GAGTGTGACATGGTGGAGAGAGG - Intronic
1149692965 17:58593707-58593729 TAGTGTGACAGTGAAGAGAGTGG - Intronic
1151386678 17:73759342-73759364 CAGGCTGAAGGGCAGGAGAGTGG - Intergenic
1151552620 17:74830827-74830849 CAGTGTGCGAGGGAGGGGAGTGG + Intronic
1151624317 17:75267203-75267225 GTGTGTGGGAGGCAGGAGAGTGG - Intronic
1152250381 17:79209393-79209415 GAGTGTGGCAGGCAGGACAGAGG + Intronic
1152909056 17:82986935-82986957 TAGTGGGACAGGGAGGAGCGGGG - Intronic
1153154415 18:2132569-2132591 TAGTTTGACAGGCAGGAGGCAGG + Intergenic
1153592310 18:6686579-6686601 CAGAGTGACAGGAAGGAGCCAGG + Intergenic
1154393496 18:13965404-13965426 CAAGGTGACAGGAAGGAGAAGGG + Intergenic
1155019412 18:21881289-21881311 CTGTGTCACAGGCTGGAGCGCGG - Intergenic
1155600973 18:27547161-27547183 CACTGGGACAGGTAGAAGAGTGG - Intergenic
1155978630 18:32158265-32158287 GAATGTGGCAGGCTGGAGAGTGG + Intronic
1155988458 18:32255030-32255052 CAGTGTGGCCGGGTGGAGAGAGG + Intronic
1156516349 18:37683829-37683851 CAGTGGCACAGGGAGGAGTGGGG + Intergenic
1156903028 18:42323334-42323356 CAGTGTGAGAGGCAGGAATAAGG + Intergenic
1157102324 18:44742273-44742295 GAGTGTGAAAGTCAGGAGACCGG - Intronic
1157413221 18:47481257-47481279 CAGTGGGACAGCCAGGAAACCGG + Intergenic
1157695950 18:49723757-49723779 CAGTGTGGGATGCAGGAGAAGGG + Intergenic
1158393035 18:57059046-57059068 CAGGGTGAGAGGCACCAGAGTGG + Intergenic
1158510406 18:58085331-58085353 CCGTGTGCCAGGCAGCAGTGTGG + Intronic
1159123896 18:64200952-64200974 CTGAATGACAGGCAGGGGAGAGG - Intergenic
1159419276 18:68195627-68195649 CACAATGGCAGGCAGGAGAGTGG + Intergenic
1159480232 18:68980777-68980799 GAGTGAGACAGGCATGGGAGAGG + Intronic
1159804706 18:72941904-72941926 CAGTGTGACGGGAAGGAGGCAGG + Intergenic
1160115751 18:76077860-76077882 CAGTGTAACAGGAGGAAGAGTGG + Intergenic
1160137225 18:76282694-76282716 GACTGTGAAAGGCAAGAGAGAGG - Intergenic
1160306012 18:77737676-77737698 CACAGAGACAGGCATGAGAGCGG - Intergenic
1160570898 18:79816978-79817000 CCATGTGACAGGCATGTGAGTGG - Intergenic
1160570933 18:79817322-79817344 CCATGTGACAGGCATGTGAGTGG - Intergenic
1161475719 19:4483719-4483741 GCGTGTGACAGGCTGGAGTGGGG - Intronic
1161509042 19:4660562-4660584 CATGGGGACAGGGAGGAGAGGGG - Intronic
1161589371 19:5122172-5122194 CACTGAGACAGGCAGGAAACAGG - Intronic
1161736538 19:5995281-5995303 GAGTGGGACAGGCAGGCCAGAGG - Intronic
1162018628 19:7858630-7858652 CTGTGTCACAGGCAGCAGACAGG + Intronic
1162127723 19:8508274-8508296 AAGGGTGCCGGGCAGGAGAGGGG + Intergenic
1162786334 19:13037190-13037212 CTGTGTGTCAGGGAGAAGAGGGG + Intronic
1163094874 19:15049883-15049905 CAGTGTGGCAGGGAGCACAGAGG - Intronic
1164115749 19:22217146-22217168 CAGTGGGAAGGGTAGGAGAGGGG - Intergenic
1164225773 19:23244524-23244546 CAGTGTGACAGCCAGTACATAGG + Intronic
1164478337 19:28592225-28592247 CAGTGTGTCAGGCAGCAGGCAGG - Intergenic
1164575134 19:29401469-29401491 CAGAGTGGGAGGCAGCAGAGTGG + Intergenic
1164827834 19:31297298-31297320 CTGTGTGGCAGGCAGGACAATGG + Intronic
1164858259 19:31542153-31542175 CAGTGAGAAAGGGAGGAGAAGGG + Intergenic
1165069774 19:33248555-33248577 AAATGGGACAGGCAGGTGAGGGG + Intergenic
1165335708 19:35168341-35168363 CAGAGTGACAGGGAAGAGAGGGG + Intronic
1166635878 19:44451787-44451809 CAGTGTCACTGCCAGGAAAGGGG + Intergenic
1166721323 19:44998141-44998163 CAGAGTGACTGACAGGAAAGGGG - Intergenic
1167056322 19:47113200-47113222 CCGTGTCACGTGCAGGAGAGGGG + Intronic
1167633597 19:50640224-50640246 CAGTGCCACAGCCAGGATAGAGG + Intronic
1168284101 19:55321906-55321928 AAGGGTGAGAGGAAGGAGAGTGG - Intronic
925362127 2:3286871-3286893 CAGAGTGCCAGCCAGCAGAGGGG + Intronic
925380346 2:3420598-3420620 CTGTGTTGAAGGCAGGAGAGTGG - Intronic
925410126 2:3635074-3635096 GAGGGGGACAGGCAGGGGAGAGG - Intronic
926056032 2:9774558-9774580 CGGAGTCACGGGCAGGAGAGTGG - Intergenic
926707581 2:15847476-15847498 CAGAGTGAGAGACTGGAGAGGGG + Intergenic
926952186 2:18254460-18254482 CAGTGAGGCAGCCAGGAGGGAGG + Intronic
927688567 2:25190665-25190687 CTATGTGCCAGGCAGGAGAGAGG + Intergenic
928137990 2:28703043-28703065 CAGGCTGTCAGGAAGGAGAGAGG - Intergenic
928375581 2:30770585-30770607 CAGGTTGCCAGGCAGGAGACAGG + Intronic
929456224 2:42068144-42068166 CAGTGTGCCAGACAGGGCAGTGG - Intergenic
929791083 2:45023600-45023622 TAGTATGACAGGCATGAGAATGG + Intergenic
929940910 2:46333403-46333425 AAGTGTTCCAGGCAGGAGTGAGG + Intronic
931289115 2:60856846-60856868 CAGTGAACCAGGCAGGACAGTGG + Intergenic
932793166 2:74673431-74673453 CAGGGCGACAGGGAGGAGATGGG - Intronic
932797395 2:74708569-74708591 CACTGTGCCAGTCAGGAAAGGGG - Intergenic
933432542 2:82202047-82202069 TAGTGAGAAAGGCAGGAGAATGG + Intergenic
933978459 2:87530532-87530554 CCCTTTGACAGGCAGGACAGCGG + Intergenic
934165613 2:89291395-89291417 CAGTTAGACAGGCATGAGATGGG + Intergenic
934201664 2:89891067-89891089 CAGTTAGACAGGCATGAGATGGG - Intergenic
934615449 2:95767924-95767946 CAGTGGGCCAGGCAGGAGAGAGG + Intergenic
934645454 2:96056634-96056656 CAGTGGGCCAGGCAGGAGAGAGG - Intergenic
934653338 2:96104528-96104550 CAGCTTCACAGGCAGGAGAAGGG - Intergenic
934681365 2:96286232-96286254 CTCTGTGGCAGGCAGGGGAGTGG - Intronic
934838858 2:97612723-97612745 CAGTGGGCCAGGCAGGAGAGAGG - Intergenic
935384914 2:102489797-102489819 CAATGTGAAAAGCAGAAGAGAGG - Intronic
935891972 2:107688608-107688630 AAGGGTGACTGGCAGGAGTGGGG - Intergenic
936315374 2:111420269-111420291 CCCTTTGACAGGCAGGACAGCGG - Intergenic
936348050 2:111690207-111690229 CAGTGTGCCCGGCTGGTGAGAGG - Intergenic
937132865 2:119526088-119526110 CACTGTCAAAGGAAGGAGAGAGG - Intergenic
938802395 2:134775142-134775164 CCATGTGACAGGCAGGATAAAGG + Intergenic
939465335 2:142547352-142547374 CTCTGTGCCAAGCAGGAGAGAGG - Intergenic
940728696 2:157364494-157364516 CAGTGTGGTAGGCAAGAGACAGG + Intergenic
940896896 2:159089565-159089587 CAGTCTGCCAGGGAGGAAAGAGG - Intronic
941644579 2:168026274-168026296 CAGAGTGAGAGCCAAGAGAGGGG - Intronic
942166957 2:173250994-173251016 CAGTTTTAAAGGCAGGAGAGTGG - Intronic
944961540 2:204880359-204880381 CAGTTTGAAATGCAGCAGAGTGG + Intronic
945720043 2:213407853-213407875 CAGAGAGAGAGACAGGAGAGAGG + Intronic
945929762 2:215843037-215843059 CAGAGTGAGAGGAGGGAGAGTGG - Intergenic
946160279 2:217831546-217831568 CACTGTGCCAGGAAGAAGAGGGG + Exonic
946326767 2:218988658-218988680 CTGTGAGACAGGCAGGACAGTGG + Intergenic
947077350 2:226359770-226359792 GTGTCTTACAGGCAGGAGAGAGG + Intergenic
947133612 2:226955046-226955068 CAGTGAGTCAGGCAGTAGACTGG + Intronic
947501690 2:230675558-230675580 CAGTGTGACTGGCTGCAGAGGGG + Intergenic
947731374 2:232433374-232433396 CAGTGTGCCCAGGAGGAGAGGGG + Intergenic
948259170 2:236590284-236590306 GAGTGGGTGAGGCAGGAGAGGGG - Intergenic
948398428 2:237664218-237664240 CAGTGGGACTGGCAGTGGAGAGG + Intronic
948684518 2:239661929-239661951 CAGTGTATCAGGAAGGAGGGCGG - Intergenic
948942744 2:241204293-241204315 CAGAGAGTCAGGCAGGAGACAGG + Intronic
948984856 2:241514657-241514679 CAGTGTGGTAGGCAGGAGAGGGG + Intergenic
1168961160 20:1871035-1871057 GAGTGTGAGAGGCAGGGGTGCGG + Intergenic
1169265394 20:4164252-4164274 CCGGGTGACAGGCAGGGGTGGGG - Intronic
1169915803 20:10681865-10681887 CATTGTCAGTGGCAGGAGAGAGG + Intergenic
1170559674 20:17546224-17546246 CATTGTGACAGGTGAGAGAGAGG + Intronic
1170877931 20:20267929-20267951 CAATGAGACAGGCAGGTGGGAGG - Intronic
1171012952 20:21518382-21518404 CCGGGGGAAAGGCAGGAGAGGGG + Intergenic
1171032700 20:21691615-21691637 CGGAGTCACAGCCAGGAGAGGGG + Intergenic
1171374567 20:24683589-24683611 CAGGGTGGCAGTCAGCAGAGGGG + Intergenic
1171446531 20:25208009-25208031 CAGGGTCACGGGCACGAGAGGGG - Intronic
1172933441 20:38601857-38601879 CAATGTGAGAGGGAGGAGTGAGG - Intergenic
1173564964 20:44032076-44032098 CGGTGTGAGGGGCAGGGGAGCGG + Intronic
1174147067 20:48459377-48459399 CAGTAGGGCAGGCAGGCGAGAGG + Intergenic
1174351846 20:49974248-49974270 CAGAGGGAAAGGGAGGAGAGGGG + Intergenic
1175190112 20:57206056-57206078 CAGTCTGACAGCTCGGAGAGGGG + Intronic
1175287331 20:57845588-57845610 AGGTGTGACAGGCAGAAGAATGG + Intergenic
1175758928 20:61548092-61548114 CAGTGTCCCATGCTGGAGAGTGG + Intronic
1176122309 20:63459549-63459571 CACAGAGACAGGCAGGAGACCGG + Intronic
1176151831 20:63595473-63595495 CAGGGTCCCAGGCAGGAGACCGG + Intronic
1176411266 21:6450737-6450759 CAGTGTGACAGGCAGGAGAGCGG - Intergenic
1176411279 21:6450786-6450808 CAGTGTGACAGGCAGGAGAGCGG - Intergenic
1177730671 21:25024326-25024348 CAGTGAGCCAGGCAGGCGGGTGG + Intergenic
1178537408 21:33421759-33421781 TAGGGTGACAGGCAGGACAGAGG - Intronic
1178685431 21:34707002-34707024 CAGTGTGGCAGGCAGTGGTGAGG + Intronic
1179025784 21:37677196-37677218 CAGTGTGACAGCCTGGGGATGGG + Intronic
1179686759 21:43059059-43059081 CAGTGTGACAGGCAGGAGAGCGG - Intronic
1179686772 21:43059108-43059130 CAGTGTGACAGGCAGGAGAGCGG - Intronic
1179819696 21:43929642-43929664 CAGTGTGTGTGGCAGGACAGGGG + Intronic
1180721584 22:17913166-17913188 CCGGGTGACAGGCAGGAGAGGGG - Intronic
1181119723 22:20657798-20657820 GAGGGTGACAAGCAGGAGGGGGG + Intergenic
1181574167 22:23783345-23783367 CAGCCTGACAGGCAGGAGTAGGG + Intronic
1181671909 22:24429548-24429570 CAGAGTGACAGGAAGGTCAGAGG - Intronic
1181752163 22:24996458-24996480 CAGTGTGTCAGCCTGGAGTGCGG + Intronic
1181804243 22:25365516-25365538 AAGTGTGCCAGGCAGGGGGGCGG + Intronic
1182110297 22:27718328-27718350 CAGAGTGACGGGGAGCAGAGAGG + Intergenic
1183079300 22:35446394-35446416 CAGTGCTAGAGTCAGGAGAGAGG - Intergenic
1183349251 22:37325429-37325451 CAGTGTGCCGGGCAGGCCAGGGG - Intergenic
1183426808 22:37744405-37744427 CAGGATGACAGGCAGGAGCCAGG + Intronic
1184470075 22:44691271-44691293 CAGGGTCACAGGCTGGTGAGGGG - Intronic
1184730476 22:46368713-46368735 CAGTGTTCTAGGGAGGAGAGGGG - Intronic
1184799696 22:46752040-46752062 AACTGAGACAGGCAAGAGAGGGG - Intergenic
1185046083 22:48529392-48529414 GAGGGTGTCAGGCAGGAGATGGG + Intronic
1185093015 22:48786446-48786468 CAGTGAGCCAGGCAGGGGATGGG + Intronic
1185236773 22:49718408-49718430 CAGTTTGCCAGGAAGGAGAAAGG - Intergenic
949736452 3:7177582-7177604 CAGAGTGACATGGAGGAGACAGG + Intronic
950630671 3:14279719-14279741 CAGGCTGGCATGCAGGAGAGAGG + Intergenic
950715134 3:14842453-14842475 CAGTGTGAGAGGCCTGAGATGGG - Intronic
950884725 3:16353317-16353339 GAGAGGGGCAGGCAGGAGAGGGG + Intronic
952410915 3:33048972-33048994 CAGAGGGAGGGGCAGGAGAGAGG + Intronic
953261080 3:41339501-41339523 GAGTGGGAGAAGCAGGAGAGGGG - Intronic
953393660 3:42549325-42549347 CATTGTGACATGCAGGACAGTGG - Intronic
953439988 3:42908757-42908779 AAATGGGACAGGCAGGTGAGTGG - Intronic
954301094 3:49701227-49701249 CTGTGGGACAAGCTGGAGAGAGG - Intronic
954671093 3:52291771-52291793 CAGTGTGACAGGTGGGATGGGGG - Exonic
955719780 3:61868446-61868468 CAGTGCATCAGGCAGCAGAGAGG - Intronic
955950554 3:64238641-64238663 CACTGTGTCAGGCAGGAGGTGGG + Intronic
956800661 3:72755087-72755109 AAGTGTAACAGGCAGAAAAGTGG + Intronic
957435433 3:80168931-80168953 CATAGTGGCAGGCAAGAGAGTGG + Intergenic
958025090 3:88040289-88040311 CAGTGATACAGGCAGGTGGGAGG - Intergenic
958733201 3:97980056-97980078 CACTGGGCCTGGCAGGAGAGGGG + Intergenic
959738150 3:109685033-109685055 CATGGTGGCAGGCAAGAGAGGGG - Intergenic
961029243 3:123587521-123587543 CAGTTTGGCAGGCAGGAGGCTGG + Intergenic
961687754 3:128646435-128646457 CACTCTGACAGGCAGAGGAGGGG + Intronic
962199055 3:133386501-133386523 ATGTGTGACAGGAAGAAGAGGGG - Intronic
962256494 3:133873334-133873356 CAGGGTGACTGGCTGGAGACTGG + Intronic
962413387 3:135161270-135161292 GAGAGTGACAGACAGGAGAATGG + Intronic
962821677 3:139054678-139054700 CAGTGGGCCAGGCAGGTGAGTGG + Intronic
962854159 3:139329272-139329294 CTCTGTGGCAGGAAGGAGAGAGG + Intronic
962871090 3:139493795-139493817 CATTGTGACCGGCAGAGGAGGGG - Intergenic
963781998 3:149495694-149495716 CTGTGTGACTAGCAGCAGAGGGG - Intronic
963861259 3:150313027-150313049 GACTGTGAGAGGCAGGAAAGGGG - Intergenic
963908658 3:150796008-150796030 CGCTGTGTCAGGCAGGAGACTGG - Intergenic
964404894 3:156338875-156338897 CAGTGTCACAGGCAGGATTGGGG + Intronic
964886763 3:161492438-161492460 CAGTGGGACAGGGAGGAAAAGGG - Intergenic
965920386 3:173906278-173906300 CAGTGGGACAGGGAGGAGAAAGG - Intronic
966341803 3:178933337-178933359 GAGGGTGAGAGGAAGGAGAGAGG + Intergenic
966548023 3:181172911-181172933 CAGTGAGTCAGGTAGGATAGTGG - Intergenic
966924064 3:184633311-184633333 GAGGGTGACAGGCAGGGCAGGGG - Intronic
967920554 3:194610983-194611005 CAGTGTGACAGTGTGGTGAGAGG + Exonic
968090750 3:195896870-195896892 CAGTTGGAGAGGCTGGAGAGGGG - Intronic
968661409 4:1800240-1800262 CAGGGTGGCTGGCAGGAGGGTGG + Intronic
969118732 4:4891113-4891135 AATTGAGACTGGCAGGAGAGCGG - Intergenic
969680480 4:8640445-8640467 CATTGTCACAGGGAAGAGAGAGG - Intergenic
969884223 4:10200952-10200974 CAGTGTCACAGACAGCACAGTGG + Intergenic
970408099 4:15782867-15782889 CTGTGTGACAGGCAGGAGAGGGG - Intronic
971975635 4:33682729-33682751 CTGTGTTACAGGGAGGAGTGTGG + Intergenic
973710417 4:53624412-53624434 CATGGTGGCAGGCAAGAGAGAGG - Intronic
973789348 4:54364065-54364087 GAGTGTGACAGGCCAGAGATGGG + Intergenic
974264067 4:59560935-59560957 CAGTGGGACTGGTTGGAGAGTGG - Intergenic
974394818 4:61321212-61321234 CAGTGTGGTAGGCAGTAGAATGG - Intronic
974809036 4:66921673-66921695 GAGAGTTACAGGCAGGAGATAGG + Intergenic
975216285 4:71759922-71759944 TAGTTTGACAGGCAGAACAGAGG - Intronic
978157911 4:105510428-105510450 AAGGCAGACAGGCAGGAGAGTGG - Intergenic
979968556 4:127106440-127106462 CAAGGTGACGGGCAGGGGAGGGG + Intergenic
980236014 4:130107562-130107584 GAGGCTGACAGGCAGGAGAATGG + Intergenic
980313747 4:131168828-131168850 CAGTGTGGCAGGTAGCAGTGTGG + Intergenic
981166165 4:141560250-141560272 CAGTGGAAAAGGCAGAAGAGGGG + Intergenic
984172878 4:176381856-176381878 CAGTGTGAGGGGCAGGGCAGTGG - Intergenic
984531727 4:180924243-180924265 CACTGGGAAAGGAAGGAGAGAGG - Intergenic
984632354 4:182074298-182074320 CAGTGTCCCAGGCAGGGTAGTGG + Intergenic
984993927 4:185409616-185409638 CATTGTGACAGGCTGAAAAGTGG + Intronic
987134858 5:14890971-14890993 CACTGTGAGTGGCAGGAGTGAGG + Intergenic
988102860 5:26704736-26704758 CAGTGGGACAAGAGGGAGAGGGG + Intergenic
988915581 5:35890881-35890903 TAGTTTGACAAGCAGGAGTGGGG + Intergenic
989115088 5:37944843-37944865 CAGAGAGAGAGACAGGAGAGAGG + Intergenic
989436433 5:41418679-41418701 CAGTGTGGCAGGAAGAAGAGAGG - Intronic
989630764 5:43480905-43480927 GAGGCTGAGAGGCAGGAGAGTGG - Intronic
989730391 5:44641417-44641439 GTGGGTGACAGGAAGGAGAGAGG - Intergenic
990237845 5:53787046-53787068 CAGTCTGCATGGCAGGAGAGAGG + Intergenic
990721405 5:58699971-58699993 CATTGGGACTGGCTGGAGAGTGG - Intronic
991161292 5:63507080-63507102 CATTGGGACAGGCTGGACAGTGG + Intergenic
991990550 5:72334508-72334530 CAGCATGACAGCCAAGAGAGTGG + Intronic
992066355 5:73113573-73113595 GAGAGTGACAGGAAGGGGAGAGG + Intergenic
992397084 5:76378227-76378249 CAGGGTGTGAAGCAGGAGAGTGG + Intergenic
993075445 5:83225065-83225087 CAGTCTAACAAGAAGGAGAGAGG - Intronic
994292305 5:98042340-98042362 CAGTGTGAGAGACTGGATAGGGG + Intergenic
994505864 5:100642137-100642159 GAGTGAGACAGCCAGGTGAGAGG + Intergenic
995239124 5:109865841-109865863 CAGTGACAGAGGCAGGAGATTGG - Intronic
995442114 5:112203499-112203521 CAGTGTGACAGGTACAAGAGAGG - Intronic
995732408 5:115259744-115259766 CAGAATGGGAGGCAGGAGAGAGG + Intronic
996281345 5:121732781-121732803 GAGTATGGCAGGAAGGAGAGAGG - Intergenic
996562777 5:124848843-124848865 AAGTGTGACTGGGAGGAGTGAGG - Intergenic
996971011 5:129367791-129367813 CAGAGTGCCAGGGAGGAGAGAGG + Intergenic
997208579 5:132064755-132064777 CAGTGAGCCAGGCTGGGGAGAGG - Intergenic
997259355 5:132454263-132454285 GAGAGAGACAGGCAGGAGGGAGG - Intronic
997407256 5:133660640-133660662 CAGTGGCACAGGCTGGGGAGAGG - Intergenic
998132420 5:139658104-139658126 AGGTGGGTCAGGCAGGAGAGGGG - Intronic
998409614 5:141899582-141899604 CAGTGCCACAGGGAAGAGAGGGG + Intergenic
998514009 5:142736609-142736631 CAGGGTGAGAGGCAGTAGTGGGG - Intergenic
999238067 5:150111693-150111715 CAGTGTGGCAGGGATGGGAGAGG - Intronic
999243040 5:150138553-150138575 CAGTCTGAAAGGGAGGAGGGAGG - Intronic
999322164 5:150622314-150622336 CATGGAGACAGGCAGTAGAGAGG - Intronic
1001083499 5:168683936-168683958 CAGTGGGTCAGGAGGGAGAGAGG + Intronic
1001301228 5:170535233-170535255 CAGTGTGTCAGCTAGGGGAGTGG - Intronic
1002399340 5:178982859-178982881 CAGCCTGACAGGCAGGAAACAGG + Intronic
1002527876 5:179824982-179825004 CAGAGTGGGAGGAAGGAGAGGGG + Intronic
1002637863 5:180617084-180617106 GAGTCTGAGGGGCAGGAGAGGGG - Intronic
1002723493 5:181280427-181280449 CAGGGTGGCAAGCAGGATAGAGG - Intergenic
1002980626 6:2133008-2133030 TAGTGAGAAAGGGAGGAGAGAGG - Intronic
1004330375 6:14715511-14715533 AAGAGAGAAAGGCAGGAGAGTGG + Intergenic
1004955299 6:20722517-20722539 CATTATGACAGGAAGCAGAGTGG - Intronic
1005824973 6:29627346-29627368 TTGTGTGACTGGCAGGAGATGGG - Intronic
1006237061 6:32642816-32642838 CAGTATGAAAGGAAGGAAAGTGG + Intronic
1006247044 6:32746446-32746468 CAGTATGAGAGGGAGGAAAGTGG + Intronic
1006447235 6:34086504-34086526 GAGTGTGGCAGGAAGGAGTGTGG - Intronic
1006621401 6:35367158-35367180 CACTGTAACAGGAAGAAGAGAGG + Intronic
1007035931 6:38673907-38673929 CAGGGTGGCAGGAAGGAGAAAGG + Intergenic
1007326799 6:41068230-41068252 CAGGGTGACAGGAAGAAAAGAGG + Intronic
1007346048 6:41229971-41229993 AAGTGTGAGAGGAAGGGGAGAGG - Intronic
1007358985 6:41342005-41342027 CAGAGGGACAGGAAGGGGAGAGG - Intronic
1007772405 6:44202162-44202184 CAGAGTGACAGACAGCAGATGGG - Intergenic
1009520932 6:64681505-64681527 CAGTTAGACAGGCATGAGTGGGG + Intronic
1011494267 6:87923185-87923207 CAGTGGGGTAGGAAGGAGAGAGG - Intergenic
1011626729 6:89289253-89289275 CAGTGGGCCAGGCTGCAGAGAGG + Intronic
1012218822 6:96623053-96623075 AATTTTGACAGGCAGGTGAGAGG - Intergenic
1012696444 6:102390653-102390675 CAGAGATACAGGGAGGAGAGTGG + Intergenic
1014285768 6:119495625-119495647 ACGCGTGACAGGCAGCAGAGGGG + Intergenic
1017787895 6:157771802-157771824 CAGTGGGTGAGGCAGGAGAATGG - Intronic
1017870853 6:158485467-158485489 CAGGATGAAAGGAAGGAGAGAGG + Intronic
1018092242 6:160355375-160355397 CAGGGTGACTGCCTGGAGAGTGG - Intronic
1019123634 6:169824978-169825000 CAGAGTTTCAGGCAGGAGTGTGG - Intergenic
1019507729 7:1401264-1401286 TAGTTTGACAGGCAGGGGCGAGG - Intergenic
1019702530 7:2480845-2480867 CTGTGTGCCACGCAGGAGGGCGG - Intergenic
1019924801 7:4185137-4185159 CAGTGCGACAGTCAGAAGAAGGG + Intronic
1020061668 7:5157093-5157115 CATGGTGACAGCCAGCAGAGTGG - Intergenic
1021405260 7:20260382-20260404 CACTGATGCAGGCAGGAGAGAGG - Intergenic
1021475388 7:21055349-21055371 TAGTGTGACAGGCAGAAGCAGGG - Intergenic
1021717148 7:23470529-23470551 AAGGGTGACTGGCAGGAGGGAGG + Intergenic
1021777750 7:24070297-24070319 CCATGTGCCAGGCAGGAGAAAGG - Intergenic
1021855868 7:24855180-24855202 GTGTGTGGCAGGCAGGGGAGGGG - Intronic
1022477446 7:30720813-30720835 CATTGTGATAGGCAGAAGAATGG + Intronic
1022497537 7:30862429-30862451 CAGTGTGCCTGGCACGTGAGAGG - Intronic
1022813115 7:33888311-33888333 CAATGGGAAAGGCAGGGGAGGGG - Intergenic
1024666360 7:51550955-51550977 CAGAGTGAGAGGAAGGGGAGAGG + Intergenic
1025607682 7:63051190-63051212 CAGAGTGAGAGGAAGGAAAGAGG - Intergenic
1025910067 7:65821058-65821080 CAGTTTGAGAGGCAGAAGATGGG + Intergenic
1026352539 7:69530186-69530208 CAGTCTGACTGGCTGGAGGGAGG + Intergenic
1027984098 7:85263356-85263378 CTATGAGACAGGCAGGACAGTGG - Intergenic
1028140094 7:87263853-87263875 CATTGTGACTGGTTGGAGAGTGG - Intergenic
1029541421 7:101184787-101184809 CAGTGGGACAGGGAGAAGAGGGG - Intergenic
1030063299 7:105640194-105640216 CAGTGTTACAGGCAGGGGCAGGG + Intronic
1030139662 7:106291858-106291880 AAGTGAGACAGCCAGGCGAGAGG + Intergenic
1030247491 7:107399512-107399534 CATGGTGGCAGGCAAGAGAGAGG - Intronic
1030377048 7:108765077-108765099 CAGTGTGACAGAAAGATGAGGGG - Intergenic
1031114664 7:117654631-117654653 CATGGTGACAGGCAAGAAAGAGG - Intronic
1031133972 7:117865730-117865752 AAATGTAACAGGCAGAAGAGTGG - Intronic
1032189031 7:129752265-129752287 CAGTGTAAAAGGAAGGAGTGGGG + Intronic
1032263229 7:130352719-130352741 GAGACTGACAGGCAGGAGGGTGG + Intronic
1032501075 7:132400378-132400400 CTGGGTGACAGGTAGGAGACAGG - Intronic
1033041564 7:137923956-137923978 AAGTGGGACAGGCTGGAGAAGGG - Intronic
1034274203 7:149816956-149816978 GCATGTGACAGGCAAGAGAGGGG - Intergenic
1035457246 7:159016592-159016614 CAGGGTGCCAAGCAGGAGGGTGG - Intergenic
1036431610 8:8697014-8697036 CAGAGTGACAGGAAATAGAGGGG + Intergenic
1037534693 8:19813484-19813506 CAGTGTTCTAGGCAGGACAGAGG + Intergenic
1037665908 8:20969963-20969985 CTGTGGCACAGGAAGGAGAGAGG - Intergenic
1037765297 8:21768841-21768863 CATTGTGGCAGACAGGACAGTGG - Intronic
1037816938 8:22117336-22117358 CATTGAGAGAGGGAGGAGAGGGG - Intronic
1038700042 8:29841367-29841389 CTGTGTGGCTGGCAGGAGAGAGG - Intergenic
1040492497 8:47937648-47937670 GAGCATGATAGGCAGGAGAGGGG - Intronic
1040572205 8:48621092-48621114 CAGTCTGACAGGCGAGGGAGGGG - Intergenic
1041214203 8:55583680-55583702 AAGTGGGGAAGGCAGGAGAGGGG + Intergenic
1041647150 8:60264555-60264577 AAGTGTCACAGGCAGTAGAAAGG + Intronic
1041977474 8:63816647-63816669 CAGGGTGGCAGGAAGGAGAAGGG + Intergenic
1042835048 8:73072108-73072130 CTGTGTGAGAGGAAGGAGAGGGG + Intronic
1044743075 8:95347291-95347313 CAGAGGCACAGGTAGGAGAGGGG - Intergenic
1045312844 8:101018155-101018177 GAGTGAGGCAGGCAGGAAAGGGG + Intergenic
1045329274 8:101141561-101141583 CAGCTTTCCAGGCAGGAGAGAGG + Intergenic
1045405758 8:101865369-101865391 CAGTGAGGCAGGGAGGAGAGAGG - Intronic
1046277395 8:111981887-111981909 CAGTGTGTGAGACAGGGGAGTGG + Intergenic
1046541595 8:115590514-115590536 CAGGGTGACAAGAAGGAGAAGGG + Intronic
1047071775 8:121353107-121353129 CAGGGTGACAGGCATGAGGCAGG - Intergenic
1048328597 8:133457091-133457113 GAGCGTGACAGGCACGGGAGAGG - Exonic
1048408841 8:134150796-134150818 CAGGGTGCCAGGCATGAGTGAGG - Intergenic
1048919012 8:139210908-139210930 CTGTGTGACAGACAGGGCAGAGG - Intergenic
1048927067 8:139280929-139280951 CAGTGTGACAGAAGGTAGAGAGG + Intergenic
1049004154 8:139844315-139844337 CAGAGTGCCTGGCAGGAGAAGGG + Intronic
1049530853 8:143154136-143154158 CAGTGACTCAGGCAGGAGAACGG - Intergenic
1050547197 9:6718967-6718989 CACTGTGTCAGGCAGGTGAGTGG + Intergenic
1051358775 9:16263665-16263687 CTGAGTGACAAGCAGGGGAGCGG + Intronic
1051534437 9:18141230-18141252 CAGTGAGAAGGGGAGGAGAGTGG + Intergenic
1053654073 9:40197680-40197702 AAGGGTGACAAGCAGGATAGGGG + Intergenic
1054366188 9:64343896-64343918 AAGGGTGACAAGCAGGATAGGGG + Intergenic
1054673818 9:67833626-67833648 AAGGGTGACAAGCAGGATAGGGG + Intergenic
1056520300 9:87395160-87395182 CTGTGTGAGAGGCAGGGGAGAGG - Intergenic
1057066736 9:92060040-92060062 CAGTGTCACAGGAGGGCGAGTGG + Intronic
1059391492 9:114002217-114002239 CAGGGTGCCAGGCAGGAGAAGGG + Intronic
1060207769 9:121692731-121692753 CACTGTGACAGGCGAAAGAGGGG - Intronic
1060506612 9:124202648-124202670 CAGTGTGTGAGGGTGGAGAGGGG - Intergenic
1061206600 9:129167495-129167517 AAGTGGGAGAGGCAGGAGATGGG - Intergenic
1061441261 9:130605475-130605497 CAGAGTGGCATGCAGGCGAGGGG - Intronic
1061860398 9:133465012-133465034 CTGTGTGACATGGAGGAAAGGGG - Intronic
1062437374 9:136552384-136552406 CAGTTGAACACGCAGGAGAGCGG + Intergenic
1062566217 9:137165059-137165081 CAGGGAGGCAGGCAGGAGCGAGG + Intronic
1062646241 9:137549995-137550017 AGCTGTGACAGGCAGCAGAGAGG + Intronic
1187359253 X:18609600-18609622 AAGTGAGAGAGGGAGGAGAGGGG - Intronic
1188117641 X:26264206-26264228 CAGTGATACAGACAGGAGACAGG - Intergenic
1188329198 X:28847705-28847727 GACTGTGACAGGCAGGGGAGCGG - Intronic
1189178400 X:38980835-38980857 CAGTGACACAGGCAGGAGGAGGG - Intergenic
1189621575 X:42845938-42845960 AAGTGAGACAGCCAGGTGAGAGG - Intergenic
1191871114 X:65746269-65746291 CAGAATGAAAGGCAGGAGATTGG - Intergenic
1191915510 X:66197744-66197766 CAGTGGGACCGGCATGAGGGGGG - Exonic
1193919112 X:87404511-87404533 CAGTTAGACAGGCATGAGTGGGG + Intergenic
1194564961 X:95474127-95474149 CAGTGTCAACTGCAGGAGAGAGG - Intergenic
1197856291 X:130917080-130917102 CAGTTTGGAAGGGAGGAGAGGGG + Intergenic
1199683393 X:150242979-150243001 CTGGGAGACAGGCAGGAGGGAGG + Intergenic
1199993275 X:153002144-153002166 CAGGGTTCCAGGCAGGAGATGGG - Intergenic
1200777089 Y:7179146-7179168 TTGTGTGGCAGGCAGGACAGAGG - Intergenic
1201719014 Y:17077131-17077153 AAGTGTGACAGGCACAAGGGAGG - Intergenic