ID: 1179690171

View in Genome Browser
Species Human (GRCh38)
Location 21:43076005-43076027
Sequence GTCCCAGGCTGCGGCGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 2, 1: 0, 2: 1, 3: 39, 4: 302}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179690171_1179690189 17 Left 1179690171 21:43076005-43076027 CCCACCCCGCCGCAGCCTGGGAC 0: 2
1: 0
2: 1
3: 39
4: 302
Right 1179690189 21:43076045-43076067 CCCCGCCCTCCCCGGGACCCCGG 0: 2
1: 0
2: 7
3: 77
4: 719
1179690171_1179690184 10 Left 1179690171 21:43076005-43076027 CCCACCCCGCCGCAGCCTGGGAC 0: 2
1: 0
2: 1
3: 39
4: 302
Right 1179690184 21:43076038-43076060 GCCCGACCCCCGCCCTCCCCGGG 0: 2
1: 0
2: 7
3: 77
4: 685
1179690171_1179690183 9 Left 1179690171 21:43076005-43076027 CCCACCCCGCCGCAGCCTGGGAC 0: 2
1: 0
2: 1
3: 39
4: 302
Right 1179690183 21:43076037-43076059 TGCCCGACCCCCGCCCTCCCCGG 0: 2
1: 0
2: 6
3: 49
4: 513

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179690171 Original CRISPR GTCCCAGGCTGCGGCGGGGT GGG (reversed) Intronic
900087580 1:905829-905851 GCTCCAGGCCGCGGTGGGGTGGG - Intergenic
900147459 1:1164702-1164724 GTCAGAGGCTGCCGGGGGGTGGG - Intergenic
900307759 1:2019407-2019429 GTCCATGGCCGCGGCGGGCTCGG - Exonic
901050477 1:6423750-6423772 GTGCCAGGCTGGGGCTGGGGCGG + Intronic
901457104 1:9369379-9369401 GTCCCAGGGTGTCGGGGGGTGGG - Exonic
902542974 1:17167315-17167337 GTTCCAGGTTGGGGCGGGGGGGG - Intergenic
902586034 1:17439031-17439053 GTCCAGGGCTGATGCGGGGTGGG - Intronic
903164299 1:21509823-21509845 GTCCCAGGCAGCGGCTCGGGAGG - Intronic
903969115 1:27107620-27107642 GGCCAGGGCTGGGGCGGGGTGGG - Intronic
904171050 1:28592443-28592465 GCCCCGGGCAGGGGCGGGGTCGG + Intronic
904194566 1:28775412-28775434 AAACCAGGCTGCGACGGGGTGGG - Intergenic
905402488 1:37713819-37713841 GTCCCAGGCTGAGCCGGGTGGGG - Intergenic
905466239 1:38155841-38155863 ATCCCAGACTCGGGCGGGGTTGG + Intergenic
905584304 1:39105221-39105243 GCCCCAGGCTGCGGCCGGCTGGG - Intronic
905720934 1:40201076-40201098 CTCCCAGGTTGCGGGGGGGGGGG - Intronic
907159333 1:52359423-52359445 TTCTCAGGCTGCGGTGGGGTTGG - Intronic
908770805 1:67593854-67593876 GTCCCAGGCTGAGGGGGTGTGGG + Intergenic
910936384 1:92486536-92486558 GCCCTAGGAGGCGGCGGGGTCGG - Intronic
911188649 1:94927147-94927169 GGCCCAGGCGGAGGCGGGGGCGG - Exonic
913341173 1:117759310-117759332 TTCCCAGGCTTCAGAGGGGTAGG + Intergenic
914764885 1:150629303-150629325 GTCTCAGGCTCCGCAGGGGTTGG - Intronic
915304758 1:154970866-154970888 GTTCGAGGTTGGGGCGGGGTGGG - Intronic
915511258 1:156388266-156388288 TTCCCAGGCTGCGCGGGGTTCGG - Intergenic
916159732 1:161897324-161897346 CTCACAGGCTGAGGCGGGGGTGG + Intronic
917850592 1:179060392-179060414 GTACCAGTCTGTGGCGTGGTAGG + Intronic
917904468 1:179575635-179575657 GTCCGAGGCTCCGGCGAGGAGGG - Exonic
918703588 1:187635533-187635555 GGCTCAGGCTGCTGCGAGGTTGG - Intergenic
918820494 1:189249443-189249465 GACACTGGCTGCGGCGGGGTTGG + Intergenic
919820416 1:201468810-201468832 GCTCCAGGCTGCGGCGGGCGCGG + Exonic
920660562 1:207911030-207911052 GGCCCAGGATGCCGCGGGGCTGG - Exonic
922416478 1:225427579-225427601 GAGCCAGGCTGCGGTGGGGCAGG + Intronic
922496512 1:226062262-226062284 GTCTCGGGCCGCGGCGGGGAGGG - Intronic
922801242 1:228365660-228365682 GTCCCAGGCTGGGGCAGGGCTGG - Intronic
923631155 1:235650101-235650123 GGCCCGGGCTGGGGCGGGGGCGG - Intronic
1063498081 10:6528384-6528406 GTCATAGGCTGGGGTGGGGTGGG + Intronic
1070330757 10:75415368-75415390 CTGCCAGGCTGTGGCGGGGTGGG + Intergenic
1072654311 10:97319678-97319700 GCCCCTGGCTGCGGCGGTGCCGG + Exonic
1072656575 10:97334326-97334348 GCCCCTGGCTGCGGCGGTGCCGG - Exonic
1072738687 10:97896667-97896689 ATCCCAGGCTGATGGGGGGTGGG - Intronic
1075066714 10:119293755-119293777 GTGCCAGGGTGGGGCTGGGTGGG + Intronic
1075999801 10:126905600-126905622 AGCCCAGGCTCCGGCGGGGCGGG + Intronic
1076189991 10:128476079-128476101 GTGGCAGGCTGAGGCGTGGTGGG - Intergenic
1076617178 10:131763169-131763191 GTCCCAGGCAGCAGCGGGTGTGG - Intergenic
1076731210 10:132440145-132440167 GTGCCAGCCTGTGGTGGGGTGGG - Intergenic
1076852818 10:133101395-133101417 GGCCCTGGGTCCGGCGGGGTGGG + Intronic
1076915879 10:133423044-133423066 GTGGCAGGCTGAGGCGGCGTGGG + Exonic
1077004494 11:346466-346488 GTCCCAGGCTGCAGGAGGCTGGG - Intergenic
1077043168 11:533390-533412 CTCCCTGGCTGGGGCGGGGCGGG + Intronic
1077528635 11:3084271-3084293 GCCCGAAGCTGCGGCGTGGTTGG - Intergenic
1077891100 11:6418887-6418909 GACCCGGGCTGCCGCAGGGTAGG + Intronic
1079328307 11:19513020-19513042 GACCCAGGCTGGGGCAGGGGCGG + Intronic
1079353683 11:19713643-19713665 GTCCCTGGCAGCGGCGGCGGGGG - Exonic
1080012326 11:27472001-27472023 GGCCCGGGCGGCGGCGGGGCGGG + Intronic
1080388643 11:31825119-31825141 TTCCCAGCCTGGGGCGGGGTGGG - Intronic
1080802225 11:35619050-35619072 GGCCCAGGCGGCGGCGTGGCTGG + Exonic
1081204143 11:40255243-40255265 ATCCCAGACTGCGTCGGGGTTGG - Intronic
1081677128 11:44976788-44976810 GACCCCGGCTGGGGCTGGGTCGG + Intergenic
1082000840 11:47393106-47393128 GCCCCAGGCAGAGGTGGGGTTGG + Intergenic
1082829437 11:57604527-57604549 GACCCTGGCTGAGGCTGGGTGGG - Intronic
1084044917 11:66562959-66562981 GTCCCAGGCGGTGGAGGGGCTGG + Intronic
1085459130 11:76682604-76682626 GTCACAGGCTGCTGGGGGGAAGG + Intergenic
1085736845 11:79046352-79046374 GACCCAGGCTTCTGAGGGGTGGG + Intronic
1086322444 11:85664749-85664771 GACCCGGGCTGCAGCGGGGGAGG - Exonic
1088522306 11:110712569-110712591 GTCCCAGCCTGCGGCGCGCCTGG + Intronic
1088899321 11:114103286-114103308 GTCTCAGGCTGGGGGGTGGTGGG - Intronic
1089256377 11:117196440-117196462 GTCCCAGGCTGGGGCATTGTGGG - Exonic
1089459593 11:118644792-118644814 GTCCCAGGCTGAGCTGGGTTGGG + Intronic
1089493260 11:118896501-118896523 GGCCCAGGCTGAGGCAGGGCGGG + Exonic
1089543562 11:119205984-119206006 GGGCCAGGCTGGGGCGGGGTCGG - Intergenic
1089557414 11:119321854-119321876 GTCCCAGGCATCGCCGGGATGGG - Intergenic
1090066244 11:123506160-123506182 GTCCCAGAGTGCAGCGGGGGAGG + Intergenic
1091124676 11:133083439-133083461 TTCCCAGGCTGGGGTGGGGTGGG - Intronic
1091267423 11:134281967-134281989 GGCCCAGGATGAGGCCGGGTGGG - Intronic
1091275184 11:134344976-134344998 GGCCCAGGATGAGGCCGGGTGGG - Intronic
1091485196 12:879888-879910 GTCACAGGCTGCAGAAGGGTTGG - Exonic
1091740978 12:2960016-2960038 GTCCCAGGGTGCGGGAAGGTGGG - Exonic
1091793208 12:3283246-3283268 GTCCGAGGCTGAGGCAGGGTAGG - Exonic
1096314032 12:50547998-50548020 GTCCAAGGCTGCTGTGGGCTAGG + Intronic
1096365523 12:51026029-51026051 GTCCTAGGCCGCGGCGGGGAAGG + Intronic
1096469897 12:51869378-51869400 GCCCCAGGCTACGGCGGGGGAGG - Intergenic
1096546550 12:52344104-52344126 GTCACAGGCTGCTGCAGGGCGGG + Intergenic
1096575284 12:52548945-52548967 TTCCCAGGGTGGGGTGGGGTAGG - Intronic
1097101071 12:56589930-56589952 CTCCCAGGGTGTGGCAGGGTGGG - Exonic
1101354740 12:103966214-103966236 TTCCCTGGCTGCGGCGGTGGTGG + Intronic
1101371882 12:104138025-104138047 GCCCCCGGCCGCGGCGGCGTTGG + Intronic
1103699679 12:122842609-122842631 GCCACAGGGTGCCGCGGGGTTGG + Intronic
1103932444 12:124457848-124457870 GTCCCAGGCTGCGGGCTGGTGGG - Intronic
1104680551 12:130748277-130748299 GTCTCAGGCTGCGTCAGGGCTGG - Intergenic
1104718990 12:131034188-131034210 GGCCCAGAGTGCGGCAGGGTGGG - Intronic
1104930921 12:132339101-132339123 GGCAGAGGCTGCGGCGAGGTGGG + Intergenic
1104961498 12:132490368-132490390 GTCCCAGGCCGCGCCGGGCCCGG + Exonic
1105303469 13:19154234-19154256 GTCCCAGGCAGCAGCTGGGTGGG + Intergenic
1106621056 13:31371476-31371498 GTCCAAGGCTGCGGTGAGCTAGG - Intergenic
1111549235 13:89784776-89784798 GACCCTGGCTGCAGCGGGGGAGG - Intergenic
1112328583 13:98460160-98460182 ATTCCAGGCTGCGGCGGAGTGGG + Intronic
1112456065 13:99565274-99565296 GGCCGAGGTTGCGGCGGGGTGGG - Intergenic
1112761174 13:102695148-102695170 GTCCTAGGCAGAGGCTGGGTGGG - Intergenic
1113592798 13:111512738-111512760 GTCCCAGGAGGAGGAGGGGTGGG + Intergenic
1113895220 13:113759887-113759909 CTCCGAGGCTGCAGCGGGCTTGG - Intronic
1113949089 13:114061199-114061221 GTCCCCGGCCGTGGCGGGGGTGG - Intronic
1114063077 14:19037811-19037833 ATTCCAGGGTGCGGCGGAGTGGG + Intergenic
1114099181 14:19362184-19362206 ATTCCAGGGTGCGGCGGAGTGGG - Intergenic
1115271889 14:31561691-31561713 GGCCCAGGCTGAGGCGTGGCGGG + Intronic
1115648110 14:35384218-35384240 GTCCCAGGTTGGGGCTGGCTGGG - Intergenic
1117478304 14:56118757-56118779 GTCCCGGGCAGCGGCGCGGGCGG + Intronic
1118346213 14:64942952-64942974 TTCCCAGGTTGCAGCAGGGTGGG - Intronic
1118971505 14:70641916-70641938 GTCCGAGGCGGCGGCGGCGGCGG + Exonic
1119852257 14:77874542-77874564 CTCCCAGGCTGGGGTGGGGCAGG + Intronic
1122114999 14:99523188-99523210 GGCCCAGGCTGGGGCTGGGCTGG + Intronic
1122217474 14:100213913-100213935 TCCCCAGGCTGCGTCAGGGTCGG + Intergenic
1122694813 14:103547385-103547407 GTCCCAGGCTTCCCCTGGGTTGG - Intergenic
1122823108 14:104356859-104356881 CTCACATGCTGCGGGGGGGTTGG + Intergenic
1123500802 15:20878788-20878810 GGCCCAGGCTGCGGCGCCGCAGG + Intergenic
1123558052 15:21452481-21452503 GGCCCAGGCTGCGGCGCCGCAGG + Intergenic
1123594280 15:21889762-21889784 GGCCCAGGCTGCGGCGCCGCAGG + Intergenic
1125462686 15:39921004-39921026 CGCCCAGGCTGCCGCGGGGAGGG + Intergenic
1125522786 15:40357500-40357522 CTCCCAGGCTGAGGTGGGGTGGG + Intergenic
1127487981 15:59437255-59437277 GGCTCAGGCTGGGGCGGGGTGGG + Intronic
1128098661 15:64979354-64979376 GTCTCAGGCTGCAGAGGGCTGGG + Intronic
1128219988 15:65962330-65962352 GTCCCAGGGTGGGGTGGGGCAGG - Intronic
1128550470 15:68595225-68595247 GTCCCAACCTGAGGCAGGGTAGG - Intronic
1128687797 15:69699705-69699727 GTCCCAGGCCACGGTGGGGTCGG - Intergenic
1128688187 15:69702790-69702812 GGCCCAGTCTGGGGCTGGGTTGG - Intergenic
1129425950 15:75463001-75463023 GTCACAGGCTGCTGAGAGGTAGG - Intergenic
1129742601 15:77997027-77997049 GTTCCAGGCAGTGGTGGGGTGGG + Exonic
1129840577 15:78740919-78740941 GTACCAGGATGTGGCGGGGAAGG - Intergenic
1130232754 15:82109266-82109288 GTCCCAGGATGTGGTGGGGTGGG + Intergenic
1131116232 15:89797762-89797784 TTCCCAGGCTGTGGCTGGGCTGG - Intronic
1202966402 15_KI270727v1_random:179653-179675 GGCCCAGGCTGCGGCGCCGCAGG + Intergenic
1132710765 16:1266069-1266091 GTCCTGGGCTGCGGGGGGCTGGG + Intergenic
1132799728 16:1746080-1746102 GTCCCAGGCAGCCGCTGGGTGGG - Intronic
1133034856 16:3028913-3028935 GTCGCAGGCAGAGGAGGGGTGGG - Intronic
1135607442 16:23836434-23836456 GTCCCAGGGTGCGGAGGGCGCGG - Intronic
1135691316 16:24539911-24539933 GTCCGAGGCGGCGGCGGCGGCGG + Intronic
1136989877 16:35145581-35145603 GTCCCAGCATGCACCGGGGTTGG + Intergenic
1137618203 16:49858855-49858877 ATCCCAGGCGCCGGCGGGGGTGG - Intergenic
1138497286 16:57416245-57416267 GGCCCGGGCAGGGGCGGGGTTGG + Intergenic
1139383578 16:66549799-66549821 CTCCCCGGCTGCGGCTGGGACGG - Intronic
1141330265 16:83104610-83104632 GTACCAGGCGGTGGCGGGGGTGG + Intronic
1142273298 16:89102284-89102306 GTCCCAGGCTTGGGCAGGGGCGG + Intronic
1142847946 17:2691132-2691154 TTCCCATCCTGCGGCGGGGGGGG - Intronic
1143320796 17:6067738-6067760 GTCCCAGACTCCTGGGGGGTGGG + Intronic
1143453914 17:7053582-7053604 GTCTCAGGCTGAGGCTGGGAAGG - Intergenic
1144186433 17:12800460-12800482 GACCCAGGCTGCAGTGGGCTCGG + Intronic
1144627802 17:16853867-16853889 GCCCCTGGCTGCGGCGGGGATGG - Intergenic
1144643203 17:16950764-16950786 GTCCCAGGCGGGGGAGGGGAGGG - Intronic
1144665159 17:17097422-17097444 GTTCCAGGCTGCGGTGAGCTAGG + Intronic
1144946428 17:18971790-18971812 GTCCTGTGCTGGGGCGGGGTTGG - Intronic
1145014485 17:19387505-19387527 GGGGCAGGCTGCGGCGGGCTGGG - Intergenic
1145159396 17:20564468-20564490 GCCCCTGGCTGCAGCGGGGATGG - Intergenic
1145260586 17:21352279-21352301 GTGCCGGGCAGCGGCTGGGTGGG - Intergenic
1147386158 17:40083623-40083645 CCCCCAGGCTGCTGAGGGGTTGG - Intronic
1148550716 17:48549430-48549452 GTCCCAGGCAGGGGCTGGGCAGG - Exonic
1148649188 17:49237477-49237499 TTCCCAGGATGGGGTGGGGTGGG - Intergenic
1149616586 17:58006414-58006436 GGCCGAGGCGGCGGCGGGGGTGG - Exonic
1151755336 17:76072451-76072473 GTCCCAGGCGGCGGCGGCGGCGG - Exonic
1151932530 17:77241539-77241561 GTCCAAGGCTGAAGCGGGGTGGG + Intergenic
1151989357 17:77564375-77564397 CTCCCTGGCTCGGGCGGGGTAGG - Intergenic
1152049142 17:77958952-77958974 GTCCTAGGCGGCGGCGGCGGCGG - Intergenic
1152237769 17:79147445-79147467 GGGCCAGGCTCCGGAGGGGTTGG - Intronic
1152468082 17:80476802-80476824 GGCCCAGGCGGGGGCGGGGGAGG - Intronic
1152573071 17:81128939-81128961 ATGCCAGCCTGCGGCAGGGTGGG - Intronic
1153741941 18:8138441-8138463 GTCCCAGGCTGGGCATGGGTGGG - Intronic
1157584334 18:48791524-48791546 GGGCCAGGCTGAGGCTGGGTGGG - Intronic
1158633892 18:59139727-59139749 CTCCCAGAATGCTGCGGGGTGGG - Exonic
1159040307 18:63318475-63318497 GTCCCGGGATGCGGCTGGATGGG + Exonic
1159798439 18:72869035-72869057 GTCCCGGGGTCCGGCGGGCTCGG - Intergenic
1160204647 18:76822726-76822748 GTCCCCGGATGCGGCGCGGGGGG + Intronic
1160255979 18:77249618-77249640 GTTCCAGGGCGCGCCGGGGTGGG - Intergenic
1160710145 19:547645-547667 GACCCAGGCTGCGGTGTGGAAGG - Intronic
1160773489 19:844143-844165 GACCCAGGCTGCAGCGGCCTCGG - Intronic
1160785727 19:899549-899571 CTCCGAGGCTGCGGCCAGGTGGG - Intronic
1160962042 19:1726354-1726376 GTTCCAGGCTGCGACGGTGTGGG - Intergenic
1161162250 19:2767975-2767997 CTGCCCGGCTGCGGCGTGGTGGG + Intronic
1161274666 19:3409178-3409200 ACCCCAGGCTGCAGCGTGGTGGG - Intronic
1161283704 19:3458495-3458517 CTCCCAGGCTTGGGTGGGGTGGG - Intronic
1161373247 19:3925391-3925413 GTCCCAGCCTGACGCTGGGTTGG - Exonic
1161561527 19:4975631-4975653 GGCCCAGGCTGGGGCGCAGTGGG + Intronic
1162555489 19:11383520-11383542 GTCCTAGGCTGGGGCGGGGCTGG - Intronic
1162951485 19:14074100-14074122 CACCCAGGCTGCGCGGGGGTGGG + Intronic
1163113795 19:15177687-15177709 AGCCCAGGCTGCGGCTGGGACGG - Exonic
1163125634 19:15242965-15242987 TTGGCAGGCTGCGGCGGGGGTGG + Exonic
1163657846 19:18558001-18558023 CCCCCGGGCTGCGGTGGGGTGGG + Intronic
1164860565 19:31559064-31559086 TTCCCAGGCTGCTGCAGAGTGGG + Intergenic
1165419875 19:35717553-35717575 CTCCCAGGGTGCCGCGGGCTCGG - Intergenic
1165956095 19:39503076-39503098 GTCCCCGGCTGGGACGGGGTGGG - Intronic
1167109074 19:47448224-47448246 TGCCCTCGCTGCGGCGGGGTGGG + Exonic
1167332932 19:48867587-48867609 GGCTCAGGCTGCTGCGAGGTCGG + Exonic
1167454465 19:49591285-49591307 GTCCCGGGCGGCCCCGGGGTGGG - Intergenic
1167648972 19:50719471-50719493 GTCCCCGTCTCCGGGGGGGTGGG - Intergenic
925927199 2:8678974-8678996 GGGCCAGGCCGCGGCGGGGCCGG - Exonic
926152445 2:10432611-10432633 GGCCCAGAGTGGGGCGGGGTAGG + Intergenic
926629402 2:15123089-15123111 CTCCCAGGCTACCTCGGGGTGGG - Intergenic
927505901 2:23614794-23614816 GCTCCAGGCTGAGGCAGGGTGGG + Intronic
927658521 2:24972028-24972050 CTGCCAGGCAGCGGCGGGGATGG - Exonic
927990232 2:27442350-27442372 GGCCCAGGTTGGGGCGGGGCCGG + Exonic
928092635 2:28385007-28385029 GTCTGAGGCTGGGGCGGGGTGGG - Intergenic
929557830 2:42936631-42936653 GCCCCAGGCAGGGGCAGGGTGGG - Intergenic
931021310 2:58047272-58047294 GTCAGGGGCCGCGGCGGGGTTGG + Intronic
932494617 2:72140229-72140251 GTGCCAGGCAGCGGGAGGGTGGG - Intronic
932699847 2:73985056-73985078 GCCCCAGGCGGCGGCGGCGGCGG + Intergenic
933724386 2:85418436-85418458 GGCCCAGGCTGGGGCCGGGTTGG - Intergenic
934746665 2:96763867-96763889 GGCAGAGGCTGCGGTGGGGTGGG + Intronic
935250044 2:101253027-101253049 GTCCCGGGAAGCGGCAGGGTCGG + Exonic
938365035 2:130727649-130727671 GTTCCGGGCTGCGGCGGGCGTGG + Intergenic
938365074 2:130727782-130727804 GCCCCGGGCTGCGGCGGGCGTGG + Intergenic
939504329 2:143026969-143026991 GGCACAGGATGGGGCGGGGTGGG + Intronic
940866188 2:158819792-158819814 GTCCCGGGGTGGGGTGGGGTGGG - Intronic
941772794 2:169362261-169362283 TTCCCCGGCTGTGGCAGGGTCGG - Intronic
942138478 2:172953748-172953770 GTCCCAGCATTCGGTGGGGTGGG + Intronic
946688830 2:222295843-222295865 TTCCCAGGCTGCTCCGGGATGGG - Intronic
947384271 2:229575636-229575658 TTCCCAGGCTGCGGTGGTGTTGG - Intronic
947827867 2:233118402-233118424 GGCCCAGACAGCGGAGGGGTGGG - Intronic
947841317 2:233209581-233209603 CCTCCAGGCTGCGGGGGGGTGGG - Intergenic
947950585 2:234143625-234143647 CTTCCAGGATGCGGAGGGGTGGG - Intergenic
1169116230 20:3067785-3067807 GGCCCAGGCTGGAGCGTGGTTGG - Intergenic
1173724364 20:45287051-45287073 ATGGCAGGCTGCGGCGAGGTGGG - Intergenic
1174116523 20:48230189-48230211 GTCCCAGGCCACTGTGGGGTAGG + Intergenic
1174142455 20:48425457-48425479 GACCCAGGCTGCAGGGGGGCAGG - Intergenic
1176236453 20:64055953-64055975 GCCCCAGGCAGCCGTGGGGTCGG - Intronic
1176412652 21:6457419-6457441 GTCCCAGGCAGGGGCGGGGCAGG - Intergenic
1176414671 21:6467683-6467705 GTCCCAGGCTGCGGCGGGGTGGG - Intergenic
1178908280 21:36653955-36653977 GGCCCAGGCTGGGGAGGGCTAGG - Intergenic
1178914467 21:36698990-36699012 CTCCAGGGCCGCGGCGGGGTCGG + Intergenic
1179413352 21:41179034-41179056 GTCCCAGGCTGCAGCCAGGGAGG + Intronic
1179688146 21:43065741-43065763 GTCCCAGGCAGGGGCGGGGCAGG - Intronic
1179690171 21:43076005-43076027 GTCCCAGGCTGCGGCGGGGTGGG - Intronic
1179839658 21:44063185-44063207 GTCTTAGGCTGCAGCGGGGCTGG - Intronic
1180481570 22:15760440-15760462 ATTCCAGGGTGCGGCGGAGTGGG + Intergenic
1181521387 22:23450552-23450574 GTCCCAGCCCCGGGCGGGGTTGG - Intergenic
1182028424 22:27138252-27138274 GTCCCAGGCAGCTAGGGGGTGGG + Intergenic
1182369651 22:29801940-29801962 TGCCCAGGCTGCCTCGGGGTGGG - Intronic
1182697452 22:32206475-32206497 GTCCGAGGCAGGGGCGGGTTGGG + Intergenic
1184126222 22:42489194-42489216 GTCCGAGGCTGCAGTGGGCTGGG + Intergenic
1184357974 22:43995437-43995459 GGCCCCGGCTGCGGCTGTGTAGG + Intronic
1184679300 22:46061745-46061767 GTCCCAGGCCGGGGTCGGGTCGG - Intronic
949856028 3:8462127-8462149 GTCCCAGGCTGGGGAGAGATGGG + Intergenic
950110715 3:10417055-10417077 TTCCCAGACGGCGGCGGGGGGGG + Intronic
950633186 3:14297820-14297842 GGGCCAGGCTGCGGCGGGGACGG - Intergenic
950633221 3:14297935-14297957 GGCCCAGGCGGCGGCGGGCCAGG - Intergenic
953627145 3:44580512-44580534 GGCCCAGGCTCCTGCGGTGTGGG + Intronic
953989872 3:47475814-47475836 CTCCCAAGCTGCGGCGGCGGCGG + Exonic
957555515 3:81761260-81761282 CTCCCCGCCTGGGGCGGGGTTGG + Intronic
961305661 3:125958170-125958192 ATCCCAGGCTGCGCCGGGCGGGG + Intergenic
961352175 3:126311055-126311077 GTCCCAGGCTGGGGCTGGGGAGG + Intergenic
961663223 3:128481374-128481396 GGTCCACGCTGTGGCGGGGTGGG - Intronic
961734665 3:128993915-128993937 GTCCCGGGCTGCGGCGGCCGAGG + Intronic
962126243 3:132621936-132621958 CACCCAGGCTGCAGTGGGGTGGG - Intronic
963060678 3:141222392-141222414 GCCACAGGCTGGGGCAGGGTAGG - Intergenic
964622727 3:158732671-158732693 GGCCCAGGCCGCGGCGGGAGAGG + Exonic
964645742 3:158956836-158956858 GTCCCAGGCAGCAGTGGGGAGGG + Intergenic
967242730 3:187456904-187456926 GTCCCAGGCTCAGGTGGGGATGG - Intergenic
967307387 3:188072233-188072255 GTCCCTGGCTGATGCGGGCTTGG - Intergenic
968460481 4:722387-722409 GCCCCAGGCAGCGGCGTGGCTGG + Intronic
968674712 4:1871344-1871366 GGCCCCGGCTGCGGCGGCGGCGG + Intergenic
968850617 4:3075126-3075148 GTCCCAGGCTACGGCGGGGATGG + Intronic
970325924 4:14925460-14925482 GTGCCAGGCTGTGGAGAGGTGGG - Intergenic
971231024 4:24800253-24800275 GTCCCTGGCCGCCGCCGGGTGGG - Exonic
975689096 4:76948319-76948341 GCCCAAGGCTGCGGGGGCGTCGG + Intergenic
975922444 4:79408237-79408259 TTCCCAGGCCACGGCGGTGTTGG + Exonic
978727140 4:111982834-111982856 TTCTCAGGCTACGGTGGGGTAGG - Intergenic
984766430 4:183403976-183403998 TTCTCAGGCTGGGGCTGGGTGGG - Intergenic
984888642 4:184473243-184473265 GGCGCGGGCCGCGGCGGGGTGGG - Intronic
988064548 5:26218119-26218141 GTCCTAGGCAGGGGTGGGGTGGG - Intergenic
989665201 5:43846177-43846199 GTCCCAGGCATCTGGGGGGTGGG + Intergenic
990825427 5:59893354-59893376 GCCCCGGGCGGCGGCGGGGGCGG + Exonic
998200469 5:140114260-140114282 GGCTCAGGCTCCGGCGGGGGCGG + Exonic
998205463 5:140154161-140154183 GTCCCAGGCTGAGGTGGGAAAGG + Intergenic
998353177 5:141514125-141514147 GAGCCAGGCTGCGGAGGGGCGGG + Intergenic
999281248 5:150367581-150367603 GTCTCATGCTGCGGGGGAGTTGG + Intronic
999534313 5:152500683-152500705 GTTCCAGGGTGGGGCTGGGTGGG - Intergenic
1001588591 5:172850303-172850325 GGCCCAGGGTGGGGTGGGGTGGG - Intronic
1002187119 5:177459570-177459592 GCCCCAGGCCTCGGCGGGGGTGG - Intronic
1002774119 6:314306-314328 GCCCCAGGCTGGGGCTTGGTAGG + Intronic
1003107708 6:3228336-3228358 GGCCCACGCTGGGGCGGGGGCGG - Intronic
1003155408 6:3589509-3589531 ATCCTAGGCTGCGGCAAGGTGGG + Intergenic
1003332292 6:5139793-5139815 CTTCCAGGCTGGGGCGTGGTGGG + Intronic
1006192936 6:32220634-32220656 GTCCCAGCCTGCAGGGGGTTGGG + Exonic
1006682126 6:35805056-35805078 GAGCCAGGCAGGGGCGGGGTGGG + Intergenic
1007114734 6:39335600-39335622 CTCCCTGGCTGCAGCTGGGTTGG + Exonic
1007305076 6:40897468-40897490 CTGCCAGGCTGGGGCGGGCTTGG - Intergenic
1007421201 6:41720771-41720793 CTCCCTGGCTGGGGTGGGGTGGG - Intronic
1007665297 6:43509944-43509966 GGCGGAGGCTGCGGCGGGGGCGG + Exonic
1008330788 6:50241317-50241339 GACCCAGGCTGCAGTGGGGGAGG - Intergenic
1014625432 6:123719251-123719273 GCCACAGGATGGGGCGGGGTGGG - Intergenic
1017011986 6:150069266-150069288 GTCCCAGCCTGGGGTGGGGCGGG - Intergenic
1017672415 6:156779291-156779313 GTCCCAGGCGGCGGCGGCGGGGG + Exonic
1018981989 6:168608192-168608214 GTCCCGGGCTTTGGCTGGGTGGG - Exonic
1019219664 6:170463732-170463754 CTCCCAGGCTGGGCCGGGGCAGG - Intergenic
1019436698 7:1025890-1025912 GTCCCAGGCAGCGTCCTGGTGGG - Intronic
1019525989 7:1480783-1480805 GACCCAGCCTGGGGAGGGGTGGG - Intronic
1019536167 7:1530921-1530943 GGCCCGGGCCGCGGCGGGGACGG + Intronic
1019589948 7:1825919-1825941 GTCCCAGCCCCAGGCGGGGTTGG + Intronic
1019705187 7:2494229-2494251 GGCCCAGGGTGGGGCAGGGTGGG - Intergenic
1019774283 7:2903192-2903214 GTCCCAGGCAGTGGCTGGCTGGG - Intergenic
1026489046 7:70846912-70846934 GGCTCAGGCTGCTGCGAGGTCGG - Intergenic
1029996427 7:105012719-105012741 GACCCAGGCCGGGGCGGGGGAGG - Intergenic
1030728637 7:112957128-112957150 GTCTCAGGGTGGGGTGGGGTGGG + Intergenic
1034257940 7:149734609-149734631 GGCCCACGCTGGGGCGGGGCTGG + Intergenic
1034494187 7:151410224-151410246 GACCCAGGCGGCGGCGGCGGAGG - Intronic
1036777526 8:11623853-11623875 GTCACAGGCTGGGGTGTGGTGGG - Intergenic
1040065593 8:43141296-43141318 CTCCCAGGCGGCGGCGGCGGCGG - Intronic
1041044987 8:53880390-53880412 GGCCTAGGCTGCGCCGGGGTGGG + Intronic
1041167368 8:55102741-55102763 GGCCCGGGCGGCGGCGGGGCGGG + Exonic
1041919799 8:63168832-63168854 GGCCCAGGCAGCGGCGGCGGCGG + Exonic
1042218295 8:66449190-66449212 GTCCCTGGCTGTGGCTGGGGGGG - Intronic
1042962870 8:74321501-74321523 GGCCCAGGCGGCGGCGGCGAAGG - Intronic
1049001891 8:139831624-139831646 GGCACAGGCTGCGGCGGTGGGGG - Intronic
1049332164 8:142060327-142060349 GTGCCAGGCTGCGGTGGTGGAGG + Intergenic
1049354748 8:142182178-142182200 GTCCCACACTGGAGCGGGGTGGG - Intergenic
1049615630 8:143574711-143574733 CTCCCGGGCTGCGGCTGGGCTGG - Intergenic
1051835728 9:21335392-21335414 GTCCCAGGATACCACGGGGTGGG + Intergenic
1053142670 9:35690933-35690955 GAGCCGGGCTGCGGCGGGGAAGG + Exonic
1055796067 9:79976109-79976131 GTCCACAGCTGCGGCGGGGGAGG + Intergenic
1056963294 9:91145472-91145494 GGCCCAAGCTGGGGTGGGGTTGG + Intergenic
1057485235 9:95477636-95477658 GTCCCAGGGTGCCGTGGGGCTGG - Exonic
1058432005 9:104928076-104928098 CTCCCGGGCTGCGGCAGGGCAGG - Exonic
1060152849 9:121299769-121299791 GTCCCCGGCTTGGGCGGGATGGG + Intronic
1061472119 9:130835197-130835219 GGCGCAGGCGGCGGCGGGGCGGG + Intronic
1061712745 9:132499034-132499056 GTCCCTGCCGGCGGCGGGGAAGG - Intronic
1062015284 9:134288168-134288190 GGGCCAGGCTGCGGCTGGGTAGG + Intergenic
1062097127 9:134709295-134709317 GTGCCTGGCTGAGGAGGGGTGGG + Intronic
1062288719 9:135785238-135785260 ACCCCAGGCTGAGGCGGCGTGGG + Intronic
1062445957 9:136594853-136594875 GTGCCAGGCTGGGGAGGGGACGG + Intergenic
1062452354 9:136620992-136621014 GCCCCAGGTGGCGGTGGGGTGGG - Intergenic
1062493711 9:136821818-136821840 GGCCCAGCCTTCCGCGGGGTGGG + Intronic
1062504380 9:136865827-136865849 GTGCCAGGGTGGGGCGGGGAGGG - Intronic
1062525003 9:136974639-136974661 ATCCCAGGCTGCAGGTGGGTGGG + Intergenic
1062549243 9:137078333-137078355 GTCCCGGTCTGTGCCGGGGTTGG - Intronic
1062630814 9:137462371-137462393 GGGCCAGGCTGGGACGGGGTAGG - Intronic
1185637778 X:1566022-1566044 GTCCCAGGCTGCAGTGAGCTAGG + Intergenic
1187304097 X:18079412-18079434 GGCCTAGGCTGCAGAGGGGTTGG + Intergenic
1187372971 X:18725751-18725773 TTCCCAAGCTGGGGTGGGGTGGG + Intronic
1187419626 X:19122764-19122786 GCCCCCGGCTGCGGTGGGGTGGG - Intergenic
1187698063 X:21940738-21940760 GTGTCAGGCTGCGGCCGGCTGGG - Exonic
1188005489 X:25013524-25013546 GTCCCAGGCCGCGGCGGCCGCGG + Exonic
1189821584 X:44873789-44873811 GTCTCTGGCGGCGGCGGGGCGGG + Intronic
1190107116 X:47568901-47568923 CTCCCAGCCTGGGGAGGGGTGGG + Intronic
1190108301 X:47574116-47574138 GGCCGAGGCTGCTGCGTGGTGGG + Exonic
1190114961 X:47620219-47620241 GGACCAGGATGAGGCGGGGTGGG - Intergenic
1192166445 X:68830060-68830082 GGAGCAGGGTGCGGCGGGGTGGG + Intronic
1195220560 X:102742313-102742335 TTCCCAGTCGGGGGCGGGGTCGG + Intronic
1196398433 X:115289999-115290021 GTCCCAGGGTTCGTCAGGGTGGG - Intronic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic