ID: 1179691514

View in Genome Browser
Species Human (GRCh38)
Location 21:43083525-43083547
Sequence AAGCCAGGAGTGGCCCCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179691514_1179691522 12 Left 1179691514 21:43083525-43083547 CCATGAGGGGCCACTCCTGGCTT No data
Right 1179691522 21:43083560-43083582 CCCCACCCCCCATCCTTCCCTGG No data
1179691514_1179691526 17 Left 1179691514 21:43083525-43083547 CCATGAGGGGCCACTCCTGGCTT No data
Right 1179691526 21:43083565-43083587 CCCCCCATCCTTCCCTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179691514 Original CRISPR AAGCCAGGAGTGGCCCCTCA TGG (reversed) Intergenic
No off target data available for this crispr