ID: 1179692748

View in Genome Browser
Species Human (GRCh38)
Location 21:43092189-43092211
Sequence CCCTGCTCTGCTCCTTGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179692748_1179692764 30 Left 1179692748 21:43092189-43092211 CCCCCACAAGGAGCAGAGCAGGG No data
Right 1179692764 21:43092242-43092264 CCAGGAGGTTTTTGAGGATGAGG No data
1179692748_1179692755 -9 Left 1179692748 21:43092189-43092211 CCCCCACAAGGAGCAGAGCAGGG No data
Right 1179692755 21:43092203-43092225 AGAGCAGGGCAGGAGAGCCTGGG No data
1179692748_1179692757 12 Left 1179692748 21:43092189-43092211 CCCCCACAAGGAGCAGAGCAGGG No data
Right 1179692757 21:43092224-43092246 GGTGACTCCCACCTAGAGCCAGG No data
1179692748_1179692758 15 Left 1179692748 21:43092189-43092211 CCCCCACAAGGAGCAGAGCAGGG No data
Right 1179692758 21:43092227-43092249 GACTCCCACCTAGAGCCAGGAGG No data
1179692748_1179692762 24 Left 1179692748 21:43092189-43092211 CCCCCACAAGGAGCAGAGCAGGG No data
Right 1179692762 21:43092236-43092258 CTAGAGCCAGGAGGTTTTTGAGG No data
1179692748_1179692754 -10 Left 1179692748 21:43092189-43092211 CCCCCACAAGGAGCAGAGCAGGG No data
Right 1179692754 21:43092202-43092224 CAGAGCAGGGCAGGAGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179692748 Original CRISPR CCCTGCTCTGCTCCTTGTGG GGG (reversed) Intergenic
No off target data available for this crispr