ID: 1179693782

View in Genome Browser
Species Human (GRCh38)
Location 21:43101169-43101191
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 2, 1: 0, 2: 0, 3: 3, 4: 68}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179693782_1179693789 20 Left 1179693782 21:43101169-43101191 CCTCCCTAGAAGGGATAAGCCTC 0: 2
1: 0
2: 0
3: 3
4: 68
Right 1179693789 21:43101212-43101234 AGTTCTTGCTGTGTGCGCCAAGG 0: 2
1: 0
2: 1
3: 15
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179693782 Original CRISPR GAGGCTTATCCCTTCTAGGG AGG (reversed) Intronic
905823702 1:41013969-41013991 GAGGCTTCTCCCTCATGGGGAGG + Intergenic
907588534 1:55643525-55643547 CAGGCTTCTCCCTTCTCGAGAGG + Intergenic
907661785 1:56400004-56400026 CAGGCTTTTCCCTTGCAGGGTGG - Intergenic
907805804 1:57818378-57818400 GATGCTTGCCCCTTCTAGGGAGG - Intronic
910992014 1:93066484-93066506 GAGGATTAAGCCTTCCAGGGAGG + Intergenic
912597064 1:110889675-110889697 AACACTTATCCCTTATAGGGTGG - Intronic
916425788 1:164678344-164678366 GAGGATTATGCCTTCTATGCTGG - Intronic
1066101655 10:32123084-32123106 GAGCCTCATCCCTTCTAAGTTGG - Intergenic
1066614631 10:37282539-37282561 GAGGCTTATCACTAATAGGAAGG + Intronic
1068954718 10:62812778-62812800 GATGCTGATCCCTTCAAGTGGGG - Exonic
1069137393 10:64782726-64782748 GAGGCTTATCACTAATAGGAAGG + Intergenic
1072317993 10:94222312-94222334 GAAGCTTACCTCCTCTAGGGAGG - Intronic
1073517735 10:104092546-104092568 GAGGCTTAACTCTACCAGGGTGG - Intergenic
1074056707 10:109928811-109928833 GAGTCTTTTCCCTCATAGGGTGG - Intergenic
1076252768 10:128996839-128996861 CAGGCTTATCCCCCCTAGGCTGG - Intergenic
1076634573 10:131873970-131873992 GAGGCATTTTCCTTCTGGGGTGG - Intergenic
1078479010 11:11659983-11660005 GAGGCCCATCCCTATTAGGGAGG - Intergenic
1079426875 11:20351996-20352018 TAGACCTCTCCCTTCTAGGGAGG - Intergenic
1083100280 11:60297625-60297647 GTGGCTTATCATTTCTAGGATGG + Intronic
1090635187 11:128686607-128686629 GAGGCTTCTCCCTCCCAGGCTGG + Intronic
1090998815 11:131891141-131891163 CAAGCTAATCCCTTGTAGGGAGG + Intronic
1099630154 12:85132376-85132398 GTGGCTTCTTCCTGCTAGGGAGG - Intronic
1102060253 12:109926224-109926246 GAGCCTTACCCCTTCTGGGTTGG + Intronic
1102173938 12:110862320-110862342 GAGGCTTTGCCCATCGAGGGTGG - Intronic
1106976714 13:35226314-35226336 GAAGCAGCTCCCTTCTAGGGAGG + Intronic
1109777653 13:67063255-67063277 GAGGTTTATCCCTGCTGGGCTGG - Intronic
1127618049 15:60706848-60706870 GAGGCTTTTTCCTTTTTGGGAGG - Intronic
1130755713 15:86760838-86760860 GTGGCTTTTCCTCTCTAGGGTGG - Intronic
1133821680 16:9242745-9242767 GAGGCTTATACAATTTAGGGGGG + Intergenic
1138820540 16:60254064-60254086 GTGGATTTTCCCTTTTAGGGGGG - Intergenic
1140731505 16:77860693-77860715 GAGGACTATCTTTTCTAGGGAGG - Intronic
1146310457 17:31764552-31764574 GAGGCTTATCACTAATAGGAAGG - Intergenic
1147434830 17:40404380-40404402 GAGATCTATCCCTTCTATGGTGG - Exonic
1152078805 17:78174148-78174170 GGGGCTTATCTCTTCAAGTGTGG - Exonic
1152735570 17:81995396-81995418 GTGGCTCATCCCCTCAAGGGAGG - Intronic
1156801883 18:41125195-41125217 TAGGCTTATCCCTTCATGGTTGG - Intergenic
1157923163 18:51734386-51734408 GAGGTTTATCACTTCTAGGTTGG - Intergenic
1167520784 19:49953326-49953348 GAGGCTGATCACTTCTTGCGGGG + Intronic
926648397 2:15315030-15315052 GAGGCTAAGACTTTCTAGGGTGG + Intronic
928468976 2:31554634-31554656 TTGGCTCATCCCTTCTAAGGTGG + Intronic
1176418289 21:6492847-6492869 GAGGCTTATCCCTTCTAGGGAGG - Intergenic
1177929469 21:27263010-27263032 GACTCTTTTCCCTTTTAGGGAGG + Intergenic
1178406675 21:32329934-32329956 GATGCTGGCCCCTTCTAGGGAGG + Intronic
1179693782 21:43101169-43101191 GAGGCTTATCCCTTCTAGGGAGG - Intronic
1182758447 22:32700315-32700337 GAGCCACATCCCTTCCAGGGAGG - Intronic
952267833 3:31803279-31803301 GAGGCTAAGGTCTTCTAGGGAGG + Intronic
959755851 3:109898172-109898194 GTGGCTTCTCACTTCTAGGAGGG + Intergenic
960053196 3:113256984-113257006 GAGGCCTATCCCCACTAGGGAGG + Intronic
961874547 3:130011702-130011724 GAAGCTTATTCCTTCTGGTGGGG - Intergenic
962254490 3:133861050-133861072 GAGGCTGAACCCTTCCATGGTGG + Intronic
963416429 3:145001014-145001036 GAGGCTTATGCCCTCTGGAGTGG + Intergenic
964122571 3:153201068-153201090 GAGCCTTATCACCTTTAGGGGGG + Intergenic
967982419 3:195073589-195073611 AAGGCTTATCCCCTCTACCGTGG - Intronic
976226483 4:82798615-82798637 GGGGCTTCTGCCTTTTAGGGGGG + Exonic
980563480 4:134507286-134507308 GAGGATTATCCCCTCTTGAGAGG - Intergenic
981599441 4:146469102-146469124 GAGGCTAATGGCTTCTAGGAGGG + Intronic
982167447 4:152627578-152627600 GAGGCTTATCCCAGCTTGGCGGG + Exonic
985739863 5:1608947-1608969 GAGGATGCTCCCTTCGAGGGTGG - Intergenic
995511007 5:112909232-112909254 GAGGCTTATCCATACTAGATAGG - Intronic
1004511795 6:16289199-16289221 GAGGCTTTTTCCTTCTGGTGGGG - Intronic
1012074088 6:94661088-94661110 TAGGATTATCCCTTTTAGGAAGG + Intergenic
1033361426 7:140640993-140641015 GTGGCTTAACCCTTCCTGGGAGG + Intronic
1039927312 8:41947024-41947046 GAGTCTTCTCACTTCTAGAGTGG - Intronic
1052057860 9:23923786-23923808 GAGGCTTATCATTACTAGGAAGG + Intergenic
1056339368 9:85610031-85610053 GGGACTAATCCATTCTAGGGAGG + Intronic
1058805630 9:108588506-108588528 GATGCTTATCCCTTTTTGGAAGG - Intergenic
1059332022 9:113541669-113541691 GAGGCTTCTTCCTTCCAAGGAGG + Intronic
1061499879 9:130995744-130995766 GGGGCTCTGCCCTTCTAGGGCGG - Intergenic
1186552737 X:10523605-10523627 GAGGCTAATCCCTTGGAGGAAGG + Intronic
1189498085 X:41528020-41528042 CAGGGTTACCTCTTCTAGGGTGG + Intronic
1192830419 X:74745281-74745303 GAGGCTTAGAACTTCTAGAGTGG - Intronic
1199776353 X:151015339-151015361 GAGGCTCCTGCCTTCCAGGGAGG - Intergenic
1201403956 Y:13631856-13631878 GAGGCTTATCACTAATAGGAAGG - Intergenic