ID: 1179693782

View in Genome Browser
Species Human (GRCh38)
Location 21:43101169-43101191
Sequence GAGGCTTATCCCTTCTAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179693782_1179693789 20 Left 1179693782 21:43101169-43101191 CCTCCCTAGAAGGGATAAGCCTC No data
Right 1179693789 21:43101212-43101234 AGTTCTTGCTGTGTGCGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179693782 Original CRISPR GAGGCTTATCCCTTCTAGGG AGG (reversed) Intronic