ID: 1179693789

View in Genome Browser
Species Human (GRCh38)
Location 21:43101212-43101234
Sequence AGTTCTTGCTGTGTGCGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 2, 1: 0, 2: 1, 3: 15, 4: 197}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179693783_1179693789 17 Left 1179693783 21:43101172-43101194 CCCTAGAAGGGATAAGCCTCCTG 0: 2
1: 0
2: 0
3: 7
4: 67
Right 1179693789 21:43101212-43101234 AGTTCTTGCTGTGTGCGCCAAGG 0: 2
1: 0
2: 1
3: 15
4: 197
1179693782_1179693789 20 Left 1179693782 21:43101169-43101191 CCTCCCTAGAAGGGATAAGCCTC 0: 2
1: 0
2: 0
3: 3
4: 68
Right 1179693789 21:43101212-43101234 AGTTCTTGCTGTGTGCGCCAAGG 0: 2
1: 0
2: 1
3: 15
4: 197
1179693780_1179693789 28 Left 1179693780 21:43101161-43101183 CCAGTGACCCTCCCTAGAAGGGA 0: 2
1: 0
2: 0
3: 11
4: 156
Right 1179693789 21:43101212-43101234 AGTTCTTGCTGTGTGCGCCAAGG 0: 2
1: 0
2: 1
3: 15
4: 197
1179693786_1179693789 1 Left 1179693786 21:43101188-43101210 CCTCCTGAACGTGGCCAAGTATC 0: 2
1: 0
2: 0
3: 3
4: 50
Right 1179693789 21:43101212-43101234 AGTTCTTGCTGTGTGCGCCAAGG 0: 2
1: 0
2: 1
3: 15
4: 197
1179693784_1179693789 16 Left 1179693784 21:43101173-43101195 CCTAGAAGGGATAAGCCTCCTGA 0: 2
1: 0
2: 0
3: 14
4: 114
Right 1179693789 21:43101212-43101234 AGTTCTTGCTGTGTGCGCCAAGG 0: 2
1: 0
2: 1
3: 15
4: 197
1179693787_1179693789 -2 Left 1179693787 21:43101191-43101213 CCTGAACGTGGCCAAGTATCAAG 0: 2
1: 0
2: 0
3: 2
4: 39
Right 1179693789 21:43101212-43101234 AGTTCTTGCTGTGTGCGCCAAGG 0: 2
1: 0
2: 1
3: 15
4: 197
1179693781_1179693789 21 Left 1179693781 21:43101168-43101190 CCCTCCCTAGAAGGGATAAGCCT 0: 2
1: 0
2: 0
3: 10
4: 91
Right 1179693789 21:43101212-43101234 AGTTCTTGCTGTGTGCGCCAAGG 0: 2
1: 0
2: 1
3: 15
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179693789 Original CRISPR AGTTCTTGCTGTGTGCGCCA AGG Intronic
903641991 1:24866630-24866652 CGTTCTGGCTGTGTGAGCCTGGG - Intergenic
909448922 1:75777173-75777195 AGGTCTTGCTATGTTGGCCAGGG - Intronic
915577974 1:156793740-156793762 AGGTCTTGCTGTGTTTCCCAGGG + Intronic
917475052 1:175362202-175362224 TGCTCTTGCTTTGTGCTCCAGGG - Intronic
918984976 1:191613839-191613861 AGTTCTGTGTGTGTGGGCCAGGG + Intergenic
924158096 1:241202331-241202353 AGTTCTTTCTGTGGGGGCCAAGG + Intronic
924629129 1:245720823-245720845 GGTTCTTGCTCTGTGCCACATGG - Intergenic
1064243720 10:13653124-13653146 AGTGCTTGCTGTGTACTCAAAGG - Intronic
1067359778 10:45568383-45568405 AGTTCTTCCAGTGTGGTCCAGGG - Intronic
1068392550 10:56416942-56416964 AGTTCTTCCAGTGTGACCCAGGG - Intergenic
1070539170 10:77403810-77403832 AGGCCTTGCTGTCTGGGCCAAGG - Intronic
1071789964 10:88942971-88942993 AGTTCTAGCTGTGTGACCCTGGG + Intronic
1072828746 10:98635586-98635608 AGGTCTTGCTGTGTTGACCAGGG - Intronic
1073210307 10:101795739-101795761 AGTTCTTCCAGTGTGGCCCAGGG - Intronic
1073301592 10:102474233-102474255 AGGTCCTGCTGTGGGTGCCAGGG + Intronic
1073407809 10:103313229-103313251 AGTTCTTCCAGTGTGGCCCAGGG - Intronic
1075536865 10:123278687-123278709 GGTCCTGGCTGTGTGAGCCAGGG + Intergenic
1077498656 11:2898828-2898850 AGTTCTTCCTGTGTGTGCAGTGG - Intronic
1078343424 11:10519900-10519922 AGTTCTTCCAGTGTGGCCCAGGG - Intronic
1081481492 11:43493758-43493780 AATTCTTCCTGTGAGGGCCAAGG - Exonic
1081767516 11:45621763-45621785 AGTTGGGGCTGTGTGCTCCATGG - Intergenic
1085080124 11:73627075-73627097 AGGTCTTGCTGTGTTGTCCAGGG - Intergenic
1085436644 11:76510321-76510343 AGGTCTTGCTGTGTCACCCAAGG - Intronic
1088115709 11:106310336-106310358 GGGTCTTGCTGTGTGGCCCAGGG - Intergenic
1088573886 11:111250977-111250999 GGTTCTTCCTGTGAGCGTCATGG + Intergenic
1089342021 11:117764496-117764518 AGTGCTTCCTGTGTGCGTGATGG - Intronic
1089351036 11:117821914-117821936 AGCTCCTGCTGTGTGCCCCTCGG + Intronic
1089599613 11:119605336-119605358 TGTTCTTGCTGTGCCAGCCATGG + Intergenic
1091070951 11:132562677-132562699 AGTTCCTGCTGTGTAGGTCATGG - Intronic
1091175156 11:133551128-133551150 AGTTCCTACTGTGTGAGACAAGG - Intergenic
1097803345 12:63939132-63939154 AGGTCTTGCTCTGTGGCCCATGG - Intronic
1100171980 12:91985602-91985624 AGTTCCGGCTGTGTGCAGCATGG - Exonic
1101363195 12:104047254-104047276 CGTTCTAGCTGTGTCCTCCATGG + Intronic
1102275619 12:111580007-111580029 AGGTCTTGCTGTGTTGCCCAGGG + Intronic
1103324095 12:120108954-120108976 AGTTCTAGCTATGTGGGCCTTGG - Intronic
1104095043 12:125549355-125549377 AGATCCTGCTGTGTGAGCTAAGG + Intronic
1105388129 13:19951090-19951112 AATTCTTCCAGTGTGGGCCAGGG + Intergenic
1106573655 13:30954479-30954501 AGATCTTGCTTTGTGGCCCAGGG + Intronic
1107512726 13:41101029-41101051 ACTTCTTGCTGTGTGACCCTGGG - Intergenic
1107570668 13:41654657-41654679 ACTTCTTGCTGTGTGGGCCTGGG + Intronic
1108072315 13:46641088-46641110 AGTTCTGAATGTGTGCCCCATGG + Intronic
1108087152 13:46805352-46805374 AATACTTGCTGTGTGCACAAAGG - Intergenic
1110346304 13:74451650-74451672 AAGTCCTGCTGTGTGTGCCATGG + Intergenic
1111481045 13:88826840-88826862 ACTTCTTGCTGTGTCCCACACGG + Intergenic
1112058530 13:95714196-95714218 AGTTTTTGCTGTGTCACCCATGG + Intronic
1112172066 13:96984169-96984191 AGCTCTGACTGTGTCCGCCAGGG - Intergenic
1117394746 14:55298274-55298296 AGTTCTTTCAGTGTGGCCCAGGG + Intronic
1118680205 14:68233325-68233347 AGTTCTGGTTGTCTGAGCCAAGG + Intronic
1121315652 14:92959593-92959615 AGCACTTGCTGTGTGAGCCGAGG + Intronic
1121642173 14:95492821-95492843 GGTTCTTACTGTGTTGGCCAGGG - Intergenic
1122257698 14:100491138-100491160 TGTGCACGCTGTGTGCGCCATGG + Intronic
1122475489 14:102005545-102005567 AGTGCTTGCTGCGAGCCCCATGG + Intronic
1122619980 14:103050563-103050585 AGGTCTTGCTGTGTTGCCCAGGG - Intronic
1125740959 15:41964306-41964328 TGTTCTGGCTGAGTGCCCCATGG + Intronic
1128179933 15:65593230-65593252 AGGTCTTGCTCTGTCCCCCAGGG - Intronic
1130754935 15:86753242-86753264 CATTCTTGCTGTGTTAGCCAAGG + Intronic
1131668090 15:94591244-94591266 AGTTCTTATTGTGTGTGGCAGGG - Intergenic
1131763025 15:95645024-95645046 AGTTCTTGATGTGTTCACAATGG + Intergenic
1132599321 16:767001-767023 AGTCCTTCCTGGGTGAGCCAGGG + Exonic
1134250210 16:12568950-12568972 AGGTCAGGCTGGGTGCGCCATGG + Exonic
1134676991 16:16097769-16097791 AGTGCCTGCTGTGTGCCACAAGG + Intronic
1137409043 16:48212351-48212373 AGTTCTTCCAGTGTGCCCCAGGG - Intronic
1137589052 16:49682327-49682349 AGAGCTTGCTGTGAGTGCCAGGG + Intronic
1139270326 16:65676052-65676074 ACTTTTTGCTGTGTGACCCATGG + Intergenic
1139763962 16:69211019-69211041 GGTTCTTGCTGTGTTGCCCAGGG + Intronic
1141509420 16:84503120-84503142 AGTTCTTCCAGTGTGGCCCAGGG - Intronic
1141723229 16:85768479-85768501 AGGTCTTGCTCTGAGCTCCAGGG + Intergenic
1143066269 17:4250758-4250780 AGTTCTAGCTGTTTGAGCCTAGG - Intronic
1144514901 17:15910694-15910716 AGTTCTTCCAGTGTGGCCCAGGG + Intergenic
1146036121 17:29408249-29408271 GGATCTTGCTGTGTCCCCCAGGG + Intronic
1149560060 17:57602278-57602300 AGTTCTTCCGGTGTGGCCCAAGG + Intronic
1150563503 17:66316596-66316618 AGTTCTTCCAGTGTGGCCCAGGG + Intronic
1151317139 17:73329907-73329929 AGTTCTTGCTATGTTGCCCAGGG - Intergenic
1151772119 17:76170564-76170586 AGTTCTGGCTGTGTGGTACAAGG + Intronic
1152427687 17:80227135-80227157 AATTCTTCCTGTGTGGCCCAGGG - Intronic
1154412022 18:14146739-14146761 AGTTCAGGATGTGGGCGCCATGG + Intergenic
1155208713 18:23582914-23582936 AGGTCTTGCTGTGTTGCCCAAGG - Intronic
1155512084 18:26588409-26588431 AGTTCTCACTGTGTGGTCCAGGG - Intronic
1155861339 18:30904367-30904389 ACTTCTTGCTGGCTGCGTCATGG + Intergenic
1156435200 18:37119501-37119523 CCTTCTTGCTGTGTCCACCATGG + Intronic
1160782677 19:884811-884833 AGGTCTTGCTGTGTCACCCAGGG - Intronic
1161417265 19:4154394-4154416 AGGTCTTGCTCTGTGACCCAGGG + Intronic
1162113517 19:8414128-8414150 AGCACTTACTGTGTGTGCCAGGG + Intronic
1163132528 19:15284365-15284387 AGTTCCTGCTTTGTCAGCCAGGG - Intronic
1163570496 19:18079006-18079028 GGGTCTTGCTGTGTTGGCCAGGG - Intronic
1165430791 19:35771097-35771119 AGGTCTTGCTGTGTTGCCCAGGG - Intergenic
1166001864 19:39882317-39882339 AGTTCTGGGTGTGTGAGCCACGG + Intronic
1166004647 19:39898568-39898590 AGTTCTGGGTGTGTGAGCCACGG + Intronic
1167608592 19:50494988-50495010 AGTGCCTCCTGTGTGCCCCATGG - Intergenic
1167834660 19:52058004-52058026 AAGTCTTGCTGTGTGGCCCAGGG - Intronic
1168168805 19:54573175-54573197 AGGTCTTGCTATGTGGCCCAGGG + Intronic
927727551 2:25438225-25438247 AGTTCTTCCAGTGTGGCCCAGGG - Intronic
930688616 2:54335790-54335812 AGTTCTTTCTGTGGGCTCTAAGG + Intronic
931076552 2:58720895-58720917 AGTTTATGCATTGTGCGCCAGGG + Intergenic
934035719 2:88087239-88087261 ACTTCTTACTGTGTGAGCCTGGG - Intronic
934786455 2:97012120-97012142 AGGTCTTGCTGTGTTGCCCATGG - Intronic
934902083 2:98167512-98167534 CGTTCCTCCTCTGTGCGCCAGGG - Intronic
935401063 2:102660702-102660724 AGTTTTTGCTGTATGCATCATGG - Intronic
937099717 2:119259507-119259529 ACTTCCTGCTGTCTGCACCATGG + Intronic
938729006 2:134131359-134131381 AGTTCTGGCTGTGTGACCCTGGG - Intronic
941180915 2:162258383-162258405 AGTCCTTGCTGTGTCCGCCAGGG + Intergenic
942597184 2:177602182-177602204 AGTTCTTGCTGTGTCGCCCATGG + Intergenic
943326926 2:186510930-186510952 AGTTCTTCCAGTGTGGCCCAGGG + Intergenic
943505088 2:188745223-188745245 AGTTCTTACAGTGTGGGCTATGG - Intronic
944242882 2:197502307-197502329 AGTTCTTCCAGTGTGGCCCAGGG + Intronic
945031944 2:205673827-205673849 TGTTGATGCTGTGTGCGCCTTGG - Intergenic
1168931216 20:1625899-1625921 AGTTCTAGCTGTGTGACCCAGGG + Intergenic
1170630746 20:18062683-18062705 CCTTATTGCTGTGTGCTCCAGGG - Intergenic
1171402064 20:24880102-24880124 AGTTCTTGCTGTGTAACCAAGGG - Intergenic
1172454673 20:35059465-35059487 GGGTCTTGCTGTGTTGGCCAGGG - Intronic
1173193696 20:40896324-40896346 AGTGCTTACTGTGTGCTCCAGGG + Intergenic
1174361980 20:50034686-50034708 GGTGCTTGCTGTGTGCCCTAGGG + Intergenic
1176418296 21:6492890-6492912 AGTTCTTGCTGTGTGCGCCAAGG + Intergenic
1176861011 21:14011588-14011610 AGTTCAGGATGTGGGCGCCATGG - Intergenic
1179557180 21:42187182-42187204 ACTTCTTGCTGTGTCTCCCATGG + Intergenic
1179693789 21:43101212-43101234 AGTTCTTGCTGTGTGCGCCAAGG + Intronic
1179776935 21:43670739-43670761 AGTTCTTCCAGTGTGACCCAGGG + Intronic
1180355772 22:11838302-11838324 AGGTCTTGCTGTGTTGCCCAGGG - Intergenic
1180382482 22:12154023-12154045 AGGTCTTGCTGTGTTGCCCAGGG + Intergenic
1181411081 22:22720265-22720287 CATTCATGCTGTGTGCACCAGGG + Intergenic
1181903603 22:26175187-26175209 AATGCTTGCTATGTGTGCCAGGG - Intronic
949847343 3:8385086-8385108 AGTTCTTCCAGTGTGGTCCAGGG - Intergenic
949969736 3:9395084-9395106 AGTTCTTGCAGTGTGGCCCAGGG - Intergenic
950481929 3:13249636-13249658 AGCTCTTGCTGTGTGACCCTAGG + Intergenic
952014275 3:28938520-28938542 AATTCTTCCAGTGTGGGCCAGGG + Intergenic
952133586 3:30392187-30392209 AGTTCAAGCTGTGTGTGACAAGG + Intergenic
952300604 3:32101479-32101501 AGTTCTTCCAGTGTGGCCCAGGG + Intergenic
953657207 3:44863162-44863184 AGTTCTTCCAGTGTGGCCCAGGG + Intronic
953790397 3:45942956-45942978 GTTTCTAGCTGTGTGCACCAGGG + Intronic
955765521 3:62340403-62340425 AGGTCTTGCTCTGTTGGCCAGGG - Intergenic
960096402 3:113694619-113694641 TCTTCTTCCTGTGTGCCCCAGGG - Intronic
967101228 3:186217416-186217438 AGATCCTCCTGTGTGCTCCAAGG + Intronic
967125250 3:186417687-186417709 ATTTCTAGCTGTGTGACCCAGGG - Intergenic
968268343 3:197379982-197380004 AGTTCTGGATGTGTACCCCAGGG - Intergenic
969077747 4:4593581-4593603 AGTCCTGGCTGGGTGCTCCATGG + Intergenic
971416559 4:26437240-26437262 AGTTCTTCCAGTGTGGTCCAGGG + Intergenic
972555475 4:40176795-40176817 AGTTCATGCTGTTTGCAGCAGGG + Intergenic
972634061 4:40867181-40867203 AGGTCATGCTGTGTCTGCCATGG - Intronic
973372410 4:49262394-49262416 AGGTCTTGCTGTGTTGCCCAGGG + Intergenic
973388589 4:49532747-49532769 AGGTCTTGCTGTGTTGCCCAGGG - Intergenic
979609406 4:122673456-122673478 AGTTCGTGCTGTTTGCAGCAGGG - Intergenic
980131111 4:128816903-128816925 AGTTCTTGCTCTGTCACCCAGGG + Intronic
981236505 4:142422400-142422422 AGTTGTTGCTGTGTCCTCCTAGG + Intronic
981265459 4:142777773-142777795 AGTTCTGGCTGTGTCTGCCCTGG + Intronic
981372606 4:143976228-143976250 AGTTCTTCCTGTGTGGCCCAGGG + Intergenic
982194275 4:152894550-152894572 ACTTCTTGGTGTGTGCTCCTAGG + Intronic
983305284 4:165976980-165977002 AGTTCTTCCAGTGTGGCCCAGGG + Intronic
983568153 4:169176047-169176069 CCTTCTTACTGTGTGCTCCATGG - Intronic
985839975 5:2298806-2298828 TGTTATTGCTGTGTGGTCCAGGG - Intergenic
986212278 5:5685369-5685391 ATTTCTGGCTGTGAGGGCCATGG + Intergenic
986572047 5:9175787-9175809 AGTCCTAGCTGTTTGCTCCAAGG + Intronic
986587866 5:9337234-9337256 AGATCTTGATGTGTACCCCAAGG - Intronic
988547345 5:32171206-32171228 AGTTCTTCCAGTGTGGCCCAGGG - Intronic
992103457 5:73429857-73429879 AGGTCTTGCTGTGTTGCCCAGGG + Intergenic
992804871 5:80327151-80327173 AGGTCTTGCTGTGTTGGCCCAGG + Intergenic
994996022 5:107064141-107064163 AGGTCTTGCTGTGTTGCCCAGGG - Intergenic
995356012 5:111238436-111238458 ACTTCTTGCTGTGTCCTCCATGG - Intronic
995451617 5:112308484-112308506 AGTTCTTGGTGTGTACACCCTGG - Intronic
995593170 5:113721026-113721048 CCTTCTTGCTATGTGCTCCATGG - Intergenic
995927028 5:117386522-117386544 AGTGCATGCTGAGTGCTCCATGG - Intergenic
997079858 5:130725494-130725516 AATTCTTCCAGTGTGCCCCAGGG + Intergenic
1001216798 5:169864005-169864027 AGTTCTGGCTGAGTGTGACAGGG + Intronic
1001571235 5:172732033-172732055 AGTTCATCCTGTGTGCGCTGTGG - Intergenic
1007749413 6:44062934-44062956 AGTCCTTGCAGGGTGAGCCAGGG - Intergenic
1007819891 6:44553507-44553529 AGTTCTTGCAGGGTGGGCCAGGG + Intergenic
1011828277 6:91336773-91336795 AGTTCTTCCTGTGTGGCCTAGGG + Intergenic
1013607383 6:111762727-111762749 AGTTCTTCCAGTGTGGCCCAGGG - Intronic
1014937764 6:127404101-127404123 AGTTCTTCCAGTGTGGCCCAGGG + Intergenic
1015947204 6:138514914-138514936 TGTTGTTGCTGTGTGAGACAGGG - Intronic
1015984912 6:138875205-138875227 AGTGCTTCCTGTCTGCTCCAGGG - Intronic
1018386138 6:163305024-163305046 AGTTGCTGCTGTGTGGGACACGG - Intronic
1018533722 6:164796467-164796489 AGTTTTTGGAGTGTGCACCATGG - Intergenic
1018802629 6:167235895-167235917 AGTTGGGGCTGTGTGCCCCACGG - Intergenic
1019701599 7:2477001-2477023 AATCCTTGCTGTATGCCCCATGG - Intergenic
1020582765 7:10026244-10026266 ACTTCTTGCTGTGGGTGCTAGGG + Intergenic
1020677338 7:11197568-11197590 AGTTCATGCTGTTTGCAGCAGGG + Intergenic
1022809191 7:33852162-33852184 AGAGATTGCTGTGTGCGCCTTGG - Intergenic
1023975314 7:45025111-45025133 ATTTCAGGCTGTGTGGGCCAGGG + Intronic
1024725938 7:52195143-52195165 AGTTCTTGCAATGTGGCCCAGGG - Intergenic
1027803414 7:82784214-82784236 AGTTCTTGCAGTGTTCAACAAGG + Intronic
1029372641 7:100158960-100158982 AGTTCTTGCTATGTTGGCCAGGG - Intergenic
1029658892 7:101945870-101945892 AGTTCTAGCTGTGTCAGCCAAGG + Intronic
1034182483 7:149148937-149148959 AGTTCTTCCAGTGTGGCCCAGGG + Intronic
1036957018 8:13199209-13199231 AGATCTTGCTGTGTTGTCCAAGG + Intronic
1037407716 8:18561848-18561870 AGATCTTGCAGTGTGAGTCAAGG + Intronic
1037441742 8:18923119-18923141 AGTTCTTCCAGTGTGGCCCAGGG - Intronic
1037919060 8:22791139-22791161 AGTTCTTTCTGTGTGTGTCTGGG - Intronic
1042487124 8:69358553-69358575 AGTTCTTGATGTGTTGCCCAAGG + Intergenic
1042938436 8:74083715-74083737 AGGTCTTGCTGTGTCACCCAGGG + Intergenic
1043037104 8:75211970-75211992 CCTTCTTGCTGTGTGGGCAAAGG + Intergenic
1046266282 8:111835114-111835136 GGTTATTTCTGTGTGCTCCAGGG - Intergenic
1046529651 8:115427078-115427100 CGTTCTTGCTGTGTTTGCCTTGG - Intronic
1046686979 8:117238614-117238636 AGTGCCTGCTGTGGGCACCATGG + Intergenic
1046760137 8:118012053-118012075 AGTTCTTGCTGTGTGAAGAAAGG - Intronic
1047160920 8:122378329-122378351 AGTTCTTGTTGTTTGAGACAGGG - Intergenic
1047418764 8:124688044-124688066 ATTTCCTGCTGTGTGTGCTAGGG - Intronic
1048059776 8:130906823-130906845 AGGTGTTACTGTGTGCCCCATGG + Intronic
1049355083 8:142183595-142183617 TTTTCTTGCTGTGTGTCCCAGGG - Intergenic
1049761690 8:144334548-144334570 AGTCCTGGCTTTGTGCGCCGCGG - Intronic
1050355867 9:4782129-4782151 AGCTCTTCCTGTCTGTGCCAGGG - Intergenic
1053098175 9:35347312-35347334 AGTACTTACTGTGTGTGCCAGGG - Intronic
1054848875 9:69825874-69825896 AGTTCTTGCTCTGGTCTCCATGG + Intronic
1056679353 9:88703738-88703760 AGGTCTTGCTATGTTGGCCAGGG - Intergenic
1056919114 9:90770595-90770617 AGTTGTTCCTGTGGGTGCCAAGG + Intergenic
1058152543 9:101478521-101478543 AGGTCTTTCTGTGTGCCCAAGGG - Intronic
1058893527 9:109381260-109381282 AGTACCTGCTGTGTCCTCCACGG - Intronic
1059236996 9:112769522-112769544 AGCTCTTCCTGTCTGTGCCAGGG - Intronic
1060885749 9:127150782-127150804 AGTGCTTGCTTTCTGCCCCAGGG + Intronic
1061443620 9:130624708-130624730 AGTTCTTCCAGTGTGGCCCAGGG + Intronic
1203553093 Un_KI270743v1:180603-180625 AGGTCTTGCTGTGTTGCCCAGGG - Intergenic
1186064770 X:5750991-5751013 GGGTCTTGCTGTGTTGGCCAGGG + Intergenic
1190080970 X:47356517-47356539 AGGTCTTGCTATGTTGGCCAGGG + Intergenic
1192474194 X:71425438-71425460 AGGTCTTGCTATGTGTGCCCAGG - Intronic
1194700163 X:97104413-97104435 AGTTCTCTCTGTGTCCCCCAGGG + Intronic
1196803863 X:119567663-119567685 AGGTCTTGCTGTGTTGCCCAGGG + Intergenic