ID: 1179698124

View in Genome Browser
Species Human (GRCh38)
Location 21:43136511-43136533
Sequence AGCTTTCTGCAGACCATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179698124_1179698133 20 Left 1179698124 21:43136511-43136533 CCTGCCATGGTCTGCAGAAAGCT No data
Right 1179698133 21:43136554-43136576 GAGACAGACGCTCGTCTCCCTGG No data
1179698124_1179698127 -2 Left 1179698124 21:43136511-43136533 CCTGCCATGGTCTGCAGAAAGCT No data
Right 1179698127 21:43136532-43136554 CTGTAAACTCTCCCTCCCCAGGG No data
1179698124_1179698126 -3 Left 1179698124 21:43136511-43136533 CCTGCCATGGTCTGCAGAAAGCT No data
Right 1179698126 21:43136531-43136553 GCTGTAAACTCTCCCTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179698124 Original CRISPR AGCTTTCTGCAGACCATGGC AGG (reversed) Intergenic
No off target data available for this crispr