ID: 1179700122

View in Genome Browser
Species Human (GRCh38)
Location 21:43148948-43148970
Sequence CACAGGGACGTGCGCACGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179700122_1179700130 18 Left 1179700122 21:43148948-43148970 CCAGCCGTGCGCACGTCCCTGTG No data
Right 1179700130 21:43148989-43149011 ACGACTTGGTCATCTTGCAGTGG No data
1179700122_1179700129 4 Left 1179700122 21:43148948-43148970 CCAGCCGTGCGCACGTCCCTGTG No data
Right 1179700129 21:43148975-43148997 CCGCAAGGAACAGAACGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179700122 Original CRISPR CACAGGGACGTGCGCACGGC TGG (reversed) Intergenic
No off target data available for this crispr