ID: 1179700368

View in Genome Browser
Species Human (GRCh38)
Location 21:43150539-43150561
Sequence CCTCCTTTACTCAAGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179700368_1179700375 0 Left 1179700368 21:43150539-43150561 CCGTCCACCTTGAGTAAAGGAGG No data
Right 1179700375 21:43150562-43150584 TGATCCTGAATGACATGGGTGGG No data
1179700368_1179700377 21 Left 1179700368 21:43150539-43150561 CCGTCCACCTTGAGTAAAGGAGG No data
Right 1179700377 21:43150583-43150605 GGCCTTGTTCAAACAGTCAAAGG No data
1179700368_1179700373 -4 Left 1179700368 21:43150539-43150561 CCGTCCACCTTGAGTAAAGGAGG No data
Right 1179700373 21:43150558-43150580 GAGGTGATCCTGAATGACATGGG No data
1179700368_1179700374 -1 Left 1179700368 21:43150539-43150561 CCGTCCACCTTGAGTAAAGGAGG No data
Right 1179700374 21:43150561-43150583 GTGATCCTGAATGACATGGGTGG No data
1179700368_1179700372 -5 Left 1179700368 21:43150539-43150561 CCGTCCACCTTGAGTAAAGGAGG No data
Right 1179700372 21:43150557-43150579 GGAGGTGATCCTGAATGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179700368 Original CRISPR CCTCCTTTACTCAAGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr