ID: 1179704201

View in Genome Browser
Species Human (GRCh38)
Location 21:43171944-43171966
Sequence AGCCTGCGGGGGCTCTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 2, 1: 0, 2: 0, 3: 17, 4: 106}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179704201_1179704215 5 Left 1179704201 21:43171944-43171966 CCCTGTGAGAGCCCCCGCAGGCT 0: 2
1: 0
2: 0
3: 17
4: 106
Right 1179704215 21:43171972-43171994 CCTTCTGCAGTCAGTGGGGCTGG 0: 2
1: 0
2: 4
3: 34
4: 288
1179704201_1179704220 25 Left 1179704201 21:43171944-43171966 CCCTGTGAGAGCCCCCGCAGGCT 0: 2
1: 0
2: 0
3: 17
4: 106
Right 1179704220 21:43171992-43172014 TGGGGCAGCTTCTCTGGCATGGG 0: 2
1: 1
2: 0
3: 26
4: 201
1179704201_1179704218 19 Left 1179704201 21:43171944-43171966 CCCTGTGAGAGCCCCCGCAGGCT 0: 2
1: 0
2: 0
3: 17
4: 106
Right 1179704218 21:43171986-43172008 TGGGGCTGGGGCAGCTTCTCTGG 0: 2
1: 1
2: 10
3: 59
4: 502
1179704201_1179704217 7 Left 1179704201 21:43171944-43171966 CCCTGTGAGAGCCCCCGCAGGCT 0: 2
1: 0
2: 0
3: 17
4: 106
Right 1179704217 21:43171974-43171996 TTCTGCAGTCAGTGGGGCTGGGG 0: 2
1: 0
2: 3
3: 33
4: 369
1179704201_1179704210 1 Left 1179704201 21:43171944-43171966 CCCTGTGAGAGCCCCCGCAGGCT 0: 2
1: 0
2: 0
3: 17
4: 106
Right 1179704210 21:43171968-43171990 GCCCCCTTCTGCAGTCAGTGGGG 0: 2
1: 0
2: 1
3: 8
4: 166
1179704201_1179704219 24 Left 1179704201 21:43171944-43171966 CCCTGTGAGAGCCCCCGCAGGCT 0: 2
1: 0
2: 0
3: 17
4: 106
Right 1179704219 21:43171991-43172013 CTGGGGCAGCTTCTCTGGCATGG 0: 2
1: 0
2: 4
3: 32
4: 290
1179704201_1179704221 26 Left 1179704201 21:43171944-43171966 CCCTGTGAGAGCCCCCGCAGGCT 0: 2
1: 0
2: 0
3: 17
4: 106
Right 1179704221 21:43171993-43172015 GGGGCAGCTTCTCTGGCATGGGG 0: 2
1: 1
2: 0
3: 27
4: 217
1179704201_1179704209 0 Left 1179704201 21:43171944-43171966 CCCTGTGAGAGCCCCCGCAGGCT 0: 2
1: 0
2: 0
3: 17
4: 106
Right 1179704209 21:43171967-43171989 GGCCCCCTTCTGCAGTCAGTGGG 0: 2
1: 0
2: 0
3: 11
4: 109
1179704201_1179704216 6 Left 1179704201 21:43171944-43171966 CCCTGTGAGAGCCCCCGCAGGCT 0: 2
1: 0
2: 0
3: 17
4: 106
Right 1179704216 21:43171973-43171995 CTTCTGCAGTCAGTGGGGCTGGG 0: 2
1: 0
2: 2
3: 21
4: 286
1179704201_1179704208 -1 Left 1179704201 21:43171944-43171966 CCCTGTGAGAGCCCCCGCAGGCT 0: 2
1: 0
2: 0
3: 17
4: 106
Right 1179704208 21:43171966-43171988 TGGCCCCCTTCTGCAGTCAGTGG 0: 2
1: 0
2: 0
3: 19
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179704201 Original CRISPR AGCCTGCGGGGGCTCTCACA GGG (reversed) Intronic
902721546 1:18307616-18307638 AGCCTGCTGGAGCACTCACAGGG - Intronic
903184092 1:21619700-21619722 AGCCTGCGGTGTCTCTCACTGGG + Intronic
903449157 1:23441266-23441288 ATTCTGCGGGGGCTCACTCAGGG + Intronic
905915686 1:41682748-41682770 AGCCTGCGGAAGCTCACTCAGGG + Intronic
906560755 1:46755167-46755189 AGGCTGTGGGGGCTCTCAGGAGG + Intergenic
907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG + Intronic
908395125 1:63718364-63718386 TCTCTGCGGGGGCTGTCACAAGG + Intergenic
913256493 1:116958918-116958940 AGCCAGCAGTGGCTCTTACATGG - Intronic
914344330 1:146785514-146785536 AACTTTCGGGGGCTCTCACGTGG - Intergenic
914904155 1:151730125-151730147 AGCTTGCGGGGGGTCTTTCATGG + Intergenic
915933038 1:160071888-160071910 AGCCTGGGGGGGATCACACCTGG + Intergenic
923016762 1:230132449-230132471 AGCCTCTGCGGGCTTTCACAGGG - Intronic
1071186996 10:83057844-83057866 AGCCTGTTGGTGGTCTCACACGG + Intergenic
1072789726 10:98309460-98309482 TGCCTGTGGGGTCTCTCACATGG + Intergenic
1076283410 10:129270940-129270962 AGCCTCCGGGGGCATTCCCAGGG - Intergenic
1080687109 11:34524840-34524862 ATCCAGCCGGGGCCCTCACAGGG - Intergenic
1084440921 11:69172733-69172755 AACCTGCTGGGGCTGCCACAGGG + Intergenic
1084674257 11:70624895-70624917 GGCCTGCGGGGGGTGTCCCAAGG + Intronic
1084761191 11:71272199-71272221 AGCCTGCCTGGGCTCTCAAAGGG + Intergenic
1085871216 11:80351532-80351554 AGACTGGGGGGGATCTCACTTGG + Intergenic
1088745245 11:112799451-112799473 AGGCCGAGGGGGCTTTCACAGGG - Intergenic
1091784395 12:3233961-3233983 AGCCTGTGGGGGCTCCGAGATGG - Intronic
1092815420 12:12308526-12308548 AGCCCCCGGGGGTTCTAACAAGG + Intergenic
1096407465 12:51354343-51354365 AGCTTGTGGGGGCTCTCTCTGGG + Exonic
1102422522 12:112815162-112815184 AGCCTGCTGGTGCTCACACACGG + Intronic
1103741378 12:123093973-123093995 AGCCTGAGGGGCCTCTCACTGGG - Intronic
1104001764 12:124864426-124864448 AGCCTGCGGGGCTTCTTCCAGGG - Intronic
1104653881 12:130558635-130558657 AGCCTGTGGTGTCACTCACAGGG + Intronic
1106833524 13:33610667-33610689 ATCCTGTGGGGGCACTCACTGGG + Intergenic
1106927018 13:34623636-34623658 AGCCTGTGGGTGTTATCACAGGG - Intergenic
1107284631 13:38777412-38777434 AGCCTGGGCGGGCTCTGACATGG + Intronic
1107522262 13:41194597-41194619 GGCCTGCTGGGGCTCTCGGACGG + Intergenic
1109407995 13:61925660-61925682 ATCCGGAGGGGGCCCTCACATGG - Intergenic
1112315472 13:98358304-98358326 AGCAGGCTGGGGCGCTCACAGGG + Intronic
1123059148 14:105586568-105586590 AGCCAGAGGCGGCTCTCTCAGGG + Intergenic
1123083477 14:105706799-105706821 AGCCAGAGGCGGCTCTCTCAGGG + Intergenic
1123125461 14:105942888-105942910 AGCCAGCGGTGGGTCTCCCACGG - Intergenic
1123203817 14:106692639-106692661 AAGCTGAGGGGGCTCTCACAGGG - Intergenic
1123208847 14:106739146-106739168 AAGCTGAGGGGGCTCTCACAGGG - Intergenic
1123908847 15:24946752-24946774 AGCCTGCAGTGGCCATCACATGG + Intronic
1127282177 15:57501850-57501872 ATCCTGCAGCGGCACTCACAGGG + Intronic
1132381366 15:101368955-101368977 TGCCTGTGGGAGGTCTCACACGG - Intronic
1133957066 16:10453366-10453388 AGCATGGTGGGGCTCTCACCAGG - Intronic
1136282134 16:29220229-29220251 AGACTGCGGGGGCGTCCACAAGG + Intergenic
1137021962 16:35436817-35436839 AGCCAGTTGGGGCTCTCACATGG + Intergenic
1139989667 16:70929835-70929857 AACTTTCGGGGGCTCTCACGTGG + Intronic
1140719556 16:77758969-77758991 ACCCTGTGGGGTCTCTTACAGGG + Intergenic
1142076467 16:88120839-88120861 AGCCAGCCGGGGCTCACACCTGG - Intergenic
1143899960 17:10166860-10166882 TGCCTGCGGGGGCTGTCCCAAGG - Intronic
1145773874 17:27512920-27512942 AGCCTCCGGGGGCGCTGGCAGGG - Intronic
1147160606 17:38567581-38567603 TGCCTGAGGGTGCTCTCCCAGGG + Intronic
1148209624 17:45800363-45800385 AGCCTGCGGGGCCTCCCCCAGGG + Intronic
1148859246 17:50595496-50595518 AGCTTGCGGGGTCTCCAACAGGG - Intronic
1150220960 17:63495649-63495671 AGCCGGCGCTGGCTCTCACCCGG + Intronic
1150628241 17:66857752-66857774 GGCCTGTGGGGGACCTCACATGG + Intronic
1150642306 17:66957838-66957860 AGCCTCCCTGGGCTCTCACCTGG - Intergenic
1151680500 17:75620369-75620391 GGCCGGCAGGGGCTCACACAGGG + Intergenic
1151733161 17:75922846-75922868 AGCCTGAGGGCGCTGTGACAGGG + Intronic
1152612014 17:81320237-81320259 AGACTGCGGGGGCTGCCACACGG - Intronic
1152795908 17:82306134-82306156 TGCCTCTGGGGGCTCACACACGG - Intergenic
1153963395 18:10159268-10159290 AGCCTGCTGGTGGTCTCACTGGG + Intergenic
1156411249 18:36829515-36829537 AGCCTGGGGGCACTCTGACAGGG - Intronic
1161902826 19:7132244-7132266 AGGCTGCGTGGGCTGTCACCGGG - Exonic
1162743068 19:12783997-12784019 AGCGTGGGGGGGCCCTCTCAGGG - Intronic
926723413 2:15979483-15979505 GGCCTGCTGGGGACCTCACAGGG - Intergenic
928199866 2:29240981-29241003 GGCCTCCCGGAGCTCTCACAAGG + Intronic
930787154 2:55282124-55282146 GGCCTGCGGGAGCTCTCAACAGG - Intergenic
941994637 2:171590836-171590858 GGTCTTCTGGGGCTCTCACAAGG - Intergenic
944054434 2:195508726-195508748 AGTCTGCAGAGGCTATCACAGGG + Intergenic
946187443 2:217988978-217989000 AGCCTGCTGGGACTTTGACATGG + Intronic
948423079 2:237872416-237872438 AGGCTTCGGGGGCTCTCACTGGG - Intronic
1172618973 20:36307187-36307209 GGGCTGGGGGGGCACTCACATGG + Intronic
1174998417 20:55599073-55599095 AGCATGTGGAGGCTGTCACAAGG - Intergenic
1176131037 20:63496952-63496974 GGCCTGTGGGAGCTCTCACCTGG - Intronic
1176428711 21:6563628-6563650 AGCCTGCGGGGGCTCTCACAGGG - Intergenic
1176810697 21:13535050-13535072 TGCCTGCTGTGGCTTTCACAAGG - Intergenic
1177645906 21:23899596-23899618 AGCCTTTGGGGGCTTCCACATGG - Intergenic
1179704201 21:43171944-43171966 AGCCTGCGGGGGCTCTCACAGGG - Intronic
1179942963 21:44651429-44651451 AGTCTGCTGTGGGTCTCACAGGG + Intronic
1182287075 22:29254912-29254934 AGCCCCCAGAGGCTCTCACAAGG + Intronic
1182877479 22:33704751-33704773 AGCTGGCGGGGGCCCTGACAAGG - Intronic
1184240844 22:43210582-43210604 AGCCTACAGGGGCACTGACAGGG - Intronic
1184246725 22:43239630-43239652 GGCCTGAGGGGGCTCACTCACGG - Intronic
1184598173 22:45526718-45526740 GGCCTGTGTGGGCTTTCACAGGG + Intronic
949114181 3:299700-299722 AGCCTAGGGGAGCTCACACAGGG - Intronic
952086365 3:29826597-29826619 AGCCTGAAATGGCTCTCACAGGG + Intronic
953926687 3:46986139-46986161 AGCCTTCAGGGGCTCTGAAAGGG - Intronic
962250385 3:133832685-133832707 AGCTTGCTGGGCCTCTCACGAGG - Intronic
965306265 3:167067558-167067580 AGGCTGCGGGGGCTACCCCAGGG + Intergenic
969451112 4:7273920-7273942 ACCATGCTGGGGCTCTGACATGG + Intronic
969496180 4:7527572-7527594 AGTCTGCAGGGGGTCTTACAGGG - Intronic
976371836 4:84298937-84298959 ACCCTGCTTGGGCTCGCACACGG - Intergenic
977714061 4:100161036-100161058 AGCCTGGGGGCACACTCACATGG + Intergenic
984966624 4:185145157-185145179 GGCCTGAGGGGGCTCTACCAGGG + Exonic
985829338 5:2216584-2216606 TGCCTCCGGGGGCTGCCACAGGG - Intergenic
990139372 5:52685100-52685122 AGCCTGCTGGTTCTCTCCCATGG - Intergenic
997346760 5:133197849-133197871 AGGCTGTGGTGACTCTCACATGG - Exonic
1002463849 5:179393888-179393910 AGCCTGCATGTGCTCTCATATGG + Intergenic
1003181198 6:3793292-3793314 AGCCTGCGGAGGCTCCCAGGTGG + Intergenic
1004886836 6:20059229-20059251 AGCCTTCTGGGGCTGTCCCAGGG - Intergenic
1009865945 6:69398137-69398159 AGCCTGGGAGGGATTTCACATGG + Intergenic
1011772730 6:90692767-90692789 AGCCTGCAGTGGGTCTCACAGGG + Intergenic
1019630251 7:2045243-2045265 GGGATACGGGGGCTCTCACAGGG - Intronic
1021555400 7:21913601-21913623 AGCCTGCAGGGGCTGGCCCAAGG - Intronic
1022516223 7:30976555-30976577 TGCCTGTGGGGGCCCTCACCTGG - Exonic
1024390558 7:48806991-48807013 AGGCTGTGCTGGCTCTCACAGGG + Intergenic
1025178028 7:56811697-56811719 GGCCTGCGGGGGCTGCCCCAAGG + Intergenic
1033729399 7:144160242-144160264 AGCCTCCTGAGGCTCTCACCAGG - Intergenic
1034268188 7:149791219-149791241 AGCCAGCGGGGCCTCCCTCAGGG - Intergenic
1035720279 8:1786065-1786087 AGCCTGCGGGGGCTCTCTATCGG + Exonic
1037826110 8:22161630-22161652 GGCCCTTGGGGGCTCTCACAGGG + Intronic
1038482967 8:27914415-27914437 AGGCTCCGGGTGCTCCCACAGGG - Intronic
1041454092 8:58039152-58039174 AGCCTGGGCTGGCACTCACAGGG + Intronic
1045354427 8:101372805-101372827 AGCCTGGTGTGGCTCTCCCAGGG - Intergenic
1046366172 8:113235785-113235807 AGCCTGCTGGGCTTCACACAAGG - Intronic
1048384811 8:133902107-133902129 ATCCTGAGGGGCCTCTCACCTGG + Intergenic
1056799320 9:89680545-89680567 ACCCTGCAGGTGCTCACACATGG - Intergenic
1057208019 9:93184787-93184809 AGCCTGCGGGGGCCGTCTCTGGG - Intergenic
1061969311 9:134035403-134035425 AGCCTATGGGGGCTGCCACAAGG + Intronic
1062529956 9:136995423-136995445 ACCCTGCCGGGGCTCTCACTCGG + Exonic
1185610790 X:1392682-1392704 AGCCTGCGGCGGCTTCCACGTGG + Exonic
1186636655 X:11413010-11413032 AGGATGCTGTGGCTCTCACAAGG + Intronic
1197374344 X:125663841-125663863 AGTCTGCTGGAGCTCTCCCATGG - Intergenic
1199703524 X:150404109-150404131 TGCCTGTGGTGGCTCTCAGAAGG - Intronic
1201158318 Y:11151636-11151658 AGCCTGCTGGGGACCTGACAGGG + Intergenic