ID: 1179706715

View in Genome Browser
Species Human (GRCh38)
Location 21:43185635-43185657
Sequence CAGGCCTCCCTGAAAGTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179706715_1179706723 1 Left 1179706715 21:43185635-43185657 CCCCAAACTTTCAGGGAGGCCTG No data
Right 1179706723 21:43185659-43185681 TGCCTGTTACATCCCTGGGAGGG No data
1179706715_1179706732 28 Left 1179706715 21:43185635-43185657 CCCCAAACTTTCAGGGAGGCCTG No data
Right 1179706732 21:43185686-43185708 GAGGGAGGGCTCCATGCCCTGGG No data
1179706715_1179706725 9 Left 1179706715 21:43185635-43185657 CCCCAAACTTTCAGGGAGGCCTG No data
Right 1179706725 21:43185667-43185689 ACATCCCTGGGAGGGATCTGAGG No data
1179706715_1179706722 0 Left 1179706715 21:43185635-43185657 CCCCAAACTTTCAGGGAGGCCTG No data
Right 1179706722 21:43185658-43185680 GTGCCTGTTACATCCCTGGGAGG No data
1179706715_1179706721 -3 Left 1179706715 21:43185635-43185657 CCCCAAACTTTCAGGGAGGCCTG No data
Right 1179706721 21:43185655-43185677 CTGGTGCCTGTTACATCCCTGGG No data
1179706715_1179706728 13 Left 1179706715 21:43185635-43185657 CCCCAAACTTTCAGGGAGGCCTG No data
Right 1179706728 21:43185671-43185693 CCCTGGGAGGGATCTGAGGGAGG No data
1179706715_1179706726 10 Left 1179706715 21:43185635-43185657 CCCCAAACTTTCAGGGAGGCCTG No data
Right 1179706726 21:43185668-43185690 CATCCCTGGGAGGGATCTGAGGG No data
1179706715_1179706720 -4 Left 1179706715 21:43185635-43185657 CCCCAAACTTTCAGGGAGGCCTG No data
Right 1179706720 21:43185654-43185676 CCTGGTGCCTGTTACATCCCTGG No data
1179706715_1179706731 27 Left 1179706715 21:43185635-43185657 CCCCAAACTTTCAGGGAGGCCTG No data
Right 1179706731 21:43185685-43185707 TGAGGGAGGGCTCCATGCCCTGG No data
1179706715_1179706730 14 Left 1179706715 21:43185635-43185657 CCCCAAACTTTCAGGGAGGCCTG No data
Right 1179706730 21:43185672-43185694 CCTGGGAGGGATCTGAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179706715 Original CRISPR CAGGCCTCCCTGAAAGTTTG GGG (reversed) Intergenic
No off target data available for this crispr