ID: 1179707990

View in Genome Browser
Species Human (GRCh38)
Location 21:43193657-43193679
Sequence GAGGATGGAGCTCAGACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179707990_1179707995 2 Left 1179707990 21:43193657-43193679 CCAGGTGTCTGAGCTCCATCCTC No data
Right 1179707995 21:43193682-43193704 GGCCGCCACCACCACGCTGCTGG No data
1179707990_1179707999 10 Left 1179707990 21:43193657-43193679 CCAGGTGTCTGAGCTCCATCCTC No data
Right 1179707999 21:43193690-43193712 CCACCACGCTGCTGGTGAGCTGG No data
1179707990_1179708000 11 Left 1179707990 21:43193657-43193679 CCAGGTGTCTGAGCTCCATCCTC No data
Right 1179708000 21:43193691-43193713 CACCACGCTGCTGGTGAGCTGGG No data
1179707990_1179708001 12 Left 1179707990 21:43193657-43193679 CCAGGTGTCTGAGCTCCATCCTC No data
Right 1179708001 21:43193692-43193714 ACCACGCTGCTGGTGAGCTGGGG No data
1179707990_1179708003 15 Left 1179707990 21:43193657-43193679 CCAGGTGTCTGAGCTCCATCCTC No data
Right 1179708003 21:43193695-43193717 ACGCTGCTGGTGAGCTGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179707990 Original CRISPR GAGGATGGAGCTCAGACACC TGG (reversed) Intergenic