ID: 1179707992

View in Genome Browser
Species Human (GRCh38)
Location 21:43193672-43193694
Sequence GGTGGTGGCGGCCAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179707992_1179708003 0 Left 1179707992 21:43193672-43193694 CCATCCTCCTGGCCGCCACCACC No data
Right 1179708003 21:43193695-43193717 ACGCTGCTGGTGAGCTGGGGCGG No data
1179707992_1179708001 -3 Left 1179707992 21:43193672-43193694 CCATCCTCCTGGCCGCCACCACC No data
Right 1179708001 21:43193692-43193714 ACCACGCTGCTGGTGAGCTGGGG No data
1179707992_1179708007 25 Left 1179707992 21:43193672-43193694 CCATCCTCCTGGCCGCCACCACC No data
Right 1179708007 21:43193720-43193742 AGAACTCAGCACCATGGTCCGGG No data
1179707992_1179708004 19 Left 1179707992 21:43193672-43193694 CCATCCTCCTGGCCGCCACCACC No data
Right 1179708004 21:43193714-43193736 GCGGCCAGAACTCAGCACCATGG No data
1179707992_1179708006 24 Left 1179707992 21:43193672-43193694 CCATCCTCCTGGCCGCCACCACC No data
Right 1179708006 21:43193719-43193741 CAGAACTCAGCACCATGGTCCGG No data
1179707992_1179708000 -4 Left 1179707992 21:43193672-43193694 CCATCCTCCTGGCCGCCACCACC No data
Right 1179708000 21:43193691-43193713 CACCACGCTGCTGGTGAGCTGGG No data
1179707992_1179707999 -5 Left 1179707992 21:43193672-43193694 CCATCCTCCTGGCCGCCACCACC No data
Right 1179707999 21:43193690-43193712 CCACCACGCTGCTGGTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179707992 Original CRISPR GGTGGTGGCGGCCAGGAGGA TGG (reversed) Intergenic