ID: 1179707994

View in Genome Browser
Species Human (GRCh38)
Location 21:43193679-43193701
Sequence GCAGCGTGGTGGTGGCGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179707994_1179708001 -10 Left 1179707994 21:43193679-43193701 CCTGGCCGCCACCACCACGCTGC No data
Right 1179708001 21:43193692-43193714 ACCACGCTGCTGGTGAGCTGGGG No data
1179707994_1179708004 12 Left 1179707994 21:43193679-43193701 CCTGGCCGCCACCACCACGCTGC No data
Right 1179708004 21:43193714-43193736 GCGGCCAGAACTCAGCACCATGG No data
1179707994_1179708006 17 Left 1179707994 21:43193679-43193701 CCTGGCCGCCACCACCACGCTGC No data
Right 1179708006 21:43193719-43193741 CAGAACTCAGCACCATGGTCCGG No data
1179707994_1179708007 18 Left 1179707994 21:43193679-43193701 CCTGGCCGCCACCACCACGCTGC No data
Right 1179708007 21:43193720-43193742 AGAACTCAGCACCATGGTCCGGG No data
1179707994_1179708003 -7 Left 1179707994 21:43193679-43193701 CCTGGCCGCCACCACCACGCTGC No data
Right 1179708003 21:43193695-43193717 ACGCTGCTGGTGAGCTGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179707994 Original CRISPR GCAGCGTGGTGGTGGCGGCC AGG (reversed) Intergenic