ID: 1179707996

View in Genome Browser
Species Human (GRCh38)
Location 21:43193684-43193706
Sequence CACCAGCAGCGTGGTGGTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179707996_1179708006 12 Left 1179707996 21:43193684-43193706 CCGCCACCACCACGCTGCTGGTG No data
Right 1179708006 21:43193719-43193741 CAGAACTCAGCACCATGGTCCGG No data
1179707996_1179708004 7 Left 1179707996 21:43193684-43193706 CCGCCACCACCACGCTGCTGGTG No data
Right 1179708004 21:43193714-43193736 GCGGCCAGAACTCAGCACCATGG No data
1179707996_1179708007 13 Left 1179707996 21:43193684-43193706 CCGCCACCACCACGCTGCTGGTG No data
Right 1179708007 21:43193720-43193742 AGAACTCAGCACCATGGTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179707996 Original CRISPR CACCAGCAGCGTGGTGGTGG CGG (reversed) Intergenic