ID: 1179707998

View in Genome Browser
Species Human (GRCh38)
Location 21:43193690-43193712
Sequence CCAGCTCACCAGCAGCGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179707998_1179708007 7 Left 1179707998 21:43193690-43193712 CCACCACGCTGCTGGTGAGCTGG No data
Right 1179708007 21:43193720-43193742 AGAACTCAGCACCATGGTCCGGG No data
1179707998_1179708010 25 Left 1179707998 21:43193690-43193712 CCACCACGCTGCTGGTGAGCTGG No data
Right 1179708010 21:43193738-43193760 CCGGGCGTTCAGCAGCAACTTGG No data
1179707998_1179708006 6 Left 1179707998 21:43193690-43193712 CCACCACGCTGCTGGTGAGCTGG No data
Right 1179708006 21:43193719-43193741 CAGAACTCAGCACCATGGTCCGG No data
1179707998_1179708004 1 Left 1179707998 21:43193690-43193712 CCACCACGCTGCTGGTGAGCTGG No data
Right 1179708004 21:43193714-43193736 GCGGCCAGAACTCAGCACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179707998 Original CRISPR CCAGCTCACCAGCAGCGTGG TGG (reversed) Intergenic