ID: 1179708002

View in Genome Browser
Species Human (GRCh38)
Location 21:43193693-43193715
Sequence GCCCCAGCTCACCAGCAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179708002_1179708004 -2 Left 1179708002 21:43193693-43193715 CCACGCTGCTGGTGAGCTGGGGC No data
Right 1179708004 21:43193714-43193736 GCGGCCAGAACTCAGCACCATGG No data
1179708002_1179708007 4 Left 1179708002 21:43193693-43193715 CCACGCTGCTGGTGAGCTGGGGC No data
Right 1179708007 21:43193720-43193742 AGAACTCAGCACCATGGTCCGGG No data
1179708002_1179708010 22 Left 1179708002 21:43193693-43193715 CCACGCTGCTGGTGAGCTGGGGC No data
Right 1179708010 21:43193738-43193760 CCGGGCGTTCAGCAGCAACTTGG No data
1179708002_1179708006 3 Left 1179708002 21:43193693-43193715 CCACGCTGCTGGTGAGCTGGGGC No data
Right 1179708006 21:43193719-43193741 CAGAACTCAGCACCATGGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179708002 Original CRISPR GCCCCAGCTCACCAGCAGCG TGG (reversed) Intergenic