ID: 1179708003

View in Genome Browser
Species Human (GRCh38)
Location 21:43193695-43193717
Sequence ACGCTGCTGGTGAGCTGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179707990_1179708003 15 Left 1179707990 21:43193657-43193679 CCAGGTGTCTGAGCTCCATCCTC No data
Right 1179708003 21:43193695-43193717 ACGCTGCTGGTGAGCTGGGGCGG No data
1179707993_1179708003 -4 Left 1179707993 21:43193676-43193698 CCTCCTGGCCGCCACCACCACGC No data
Right 1179708003 21:43193695-43193717 ACGCTGCTGGTGAGCTGGGGCGG No data
1179707994_1179708003 -7 Left 1179707994 21:43193679-43193701 CCTGGCCGCCACCACCACGCTGC No data
Right 1179708003 21:43193695-43193717 ACGCTGCTGGTGAGCTGGGGCGG No data
1179707992_1179708003 0 Left 1179707992 21:43193672-43193694 CCATCCTCCTGGCCGCCACCACC No data
Right 1179708003 21:43193695-43193717 ACGCTGCTGGTGAGCTGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179708003 Original CRISPR ACGCTGCTGGTGAGCTGGGG CGG Intergenic