ID: 1179708004

View in Genome Browser
Species Human (GRCh38)
Location 21:43193714-43193736
Sequence GCGGCCAGAACTCAGCACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179707998_1179708004 1 Left 1179707998 21:43193690-43193712 CCACCACGCTGCTGGTGAGCTGG No data
Right 1179708004 21:43193714-43193736 GCGGCCAGAACTCAGCACCATGG No data
1179707992_1179708004 19 Left 1179707992 21:43193672-43193694 CCATCCTCCTGGCCGCCACCACC No data
Right 1179708004 21:43193714-43193736 GCGGCCAGAACTCAGCACCATGG No data
1179707997_1179708004 4 Left 1179707997 21:43193687-43193709 CCACCACCACGCTGCTGGTGAGC No data
Right 1179708004 21:43193714-43193736 GCGGCCAGAACTCAGCACCATGG No data
1179707993_1179708004 15 Left 1179707993 21:43193676-43193698 CCTCCTGGCCGCCACCACCACGC No data
Right 1179708004 21:43193714-43193736 GCGGCCAGAACTCAGCACCATGG No data
1179707994_1179708004 12 Left 1179707994 21:43193679-43193701 CCTGGCCGCCACCACCACGCTGC No data
Right 1179708004 21:43193714-43193736 GCGGCCAGAACTCAGCACCATGG No data
1179708002_1179708004 -2 Left 1179708002 21:43193693-43193715 CCACGCTGCTGGTGAGCTGGGGC No data
Right 1179708004 21:43193714-43193736 GCGGCCAGAACTCAGCACCATGG No data
1179707996_1179708004 7 Left 1179707996 21:43193684-43193706 CCGCCACCACCACGCTGCTGGTG No data
Right 1179708004 21:43193714-43193736 GCGGCCAGAACTCAGCACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179708004 Original CRISPR GCGGCCAGAACTCAGCACCA TGG Intergenic