ID: 1179708005

View in Genome Browser
Species Human (GRCh38)
Location 21:43193718-43193740
Sequence CGGACCATGGTGCTGAGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179708005_1179708012 20 Left 1179708005 21:43193718-43193740 CCAGAACTCAGCACCATGGTCCG No data
Right 1179708012 21:43193761-43193783 ATTCCTCATTGCTCTGCGGCTGG No data
1179708005_1179708013 21 Left 1179708005 21:43193718-43193740 CCAGAACTCAGCACCATGGTCCG No data
Right 1179708013 21:43193762-43193784 TTCCTCATTGCTCTGCGGCTGGG No data
1179708005_1179708010 -3 Left 1179708005 21:43193718-43193740 CCAGAACTCAGCACCATGGTCCG No data
Right 1179708010 21:43193738-43193760 CCGGGCGTTCAGCAGCAACTTGG No data
1179708005_1179708011 16 Left 1179708005 21:43193718-43193740 CCAGAACTCAGCACCATGGTCCG No data
Right 1179708011 21:43193757-43193779 TTGGATTCCTCATTGCTCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179708005 Original CRISPR CGGACCATGGTGCTGAGTTC TGG (reversed) Intergenic