ID: 1179708009

View in Genome Browser
Species Human (GRCh38)
Location 21:43193738-43193760
Sequence CCAAGTTGCTGCTGAACGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179708009_1179708015 15 Left 1179708009 21:43193738-43193760 CCGGGCGTTCAGCAGCAACTTGG No data
Right 1179708015 21:43193776-43193798 GCGGCTGGGCATCCCACAGCCGG No data
1179708009_1179708011 -4 Left 1179708009 21:43193738-43193760 CCGGGCGTTCAGCAGCAACTTGG No data
Right 1179708011 21:43193757-43193779 TTGGATTCCTCATTGCTCTGCGG No data
1179708009_1179708018 21 Left 1179708009 21:43193738-43193760 CCGGGCGTTCAGCAGCAACTTGG No data
Right 1179708018 21:43193782-43193804 GGGCATCCCACAGCCGGGACGGG No data
1179708009_1179708024 29 Left 1179708009 21:43193738-43193760 CCGGGCGTTCAGCAGCAACTTGG No data
Right 1179708024 21:43193790-43193812 CACAGCCGGGACGGGGGCTTGGG No data
1179708009_1179708019 22 Left 1179708009 21:43193738-43193760 CCGGGCGTTCAGCAGCAACTTGG No data
Right 1179708019 21:43193783-43193805 GGCATCCCACAGCCGGGACGGGG No data
1179708009_1179708012 0 Left 1179708009 21:43193738-43193760 CCGGGCGTTCAGCAGCAACTTGG No data
Right 1179708012 21:43193761-43193783 ATTCCTCATTGCTCTGCGGCTGG No data
1179708009_1179708013 1 Left 1179708009 21:43193738-43193760 CCGGGCGTTCAGCAGCAACTTGG No data
Right 1179708013 21:43193762-43193784 TTCCTCATTGCTCTGCGGCTGGG No data
1179708009_1179708016 16 Left 1179708009 21:43193738-43193760 CCGGGCGTTCAGCAGCAACTTGG No data
Right 1179708016 21:43193777-43193799 CGGCTGGGCATCCCACAGCCGGG No data
1179708009_1179708020 23 Left 1179708009 21:43193738-43193760 CCGGGCGTTCAGCAGCAACTTGG No data
Right 1179708020 21:43193784-43193806 GCATCCCACAGCCGGGACGGGGG No data
1179708009_1179708017 20 Left 1179708009 21:43193738-43193760 CCGGGCGTTCAGCAGCAACTTGG No data
Right 1179708017 21:43193781-43193803 TGGGCATCCCACAGCCGGGACGG No data
1179708009_1179708023 28 Left 1179708009 21:43193738-43193760 CCGGGCGTTCAGCAGCAACTTGG No data
Right 1179708023 21:43193789-43193811 CCACAGCCGGGACGGGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179708009 Original CRISPR CCAAGTTGCTGCTGAACGCC CGG (reversed) Intergenic