ID: 1179708010

View in Genome Browser
Species Human (GRCh38)
Location 21:43193738-43193760
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179707997_1179708010 28 Left 1179707997 21:43193687-43193709 CCACCACCACGCTGCTGGTGAGC No data
Right 1179708010 21:43193738-43193760 CCGGGCGTTCAGCAGCAACTTGG No data
1179707998_1179708010 25 Left 1179707998 21:43193690-43193712 CCACCACGCTGCTGGTGAGCTGG No data
Right 1179708010 21:43193738-43193760 CCGGGCGTTCAGCAGCAACTTGG No data
1179708005_1179708010 -3 Left 1179708005 21:43193718-43193740 CCAGAACTCAGCACCATGGTCCG No data
Right 1179708010 21:43193738-43193760 CCGGGCGTTCAGCAGCAACTTGG No data
1179708002_1179708010 22 Left 1179708002 21:43193693-43193715 CCACGCTGCTGGTGAGCTGGGGC No data
Right 1179708010 21:43193738-43193760 CCGGGCGTTCAGCAGCAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179708010 Original CRISPR CCGGGCGTTCAGCAGCAACT TGG Intergenic
No off target data available for this crispr