ID: 1179708011

View in Genome Browser
Species Human (GRCh38)
Location 21:43193757-43193779
Sequence TTGGATTCCTCATTGCTCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179708009_1179708011 -4 Left 1179708009 21:43193738-43193760 CCGGGCGTTCAGCAGCAACTTGG No data
Right 1179708011 21:43193757-43193779 TTGGATTCCTCATTGCTCTGCGG No data
1179708008_1179708011 3 Left 1179708008 21:43193731-43193753 CCATGGTCCGGGCGTTCAGCAGC No data
Right 1179708011 21:43193757-43193779 TTGGATTCCTCATTGCTCTGCGG No data
1179708005_1179708011 16 Left 1179708005 21:43193718-43193740 CCAGAACTCAGCACCATGGTCCG No data
Right 1179708011 21:43193757-43193779 TTGGATTCCTCATTGCTCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179708011 Original CRISPR TTGGATTCCTCATTGCTCTG CGG Intergenic