ID: 1179708029

View in Genome Browser
Species Human (GRCh38)
Location 21:43193813-43193835
Sequence GAACCAGGAGGGGCCTCGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179708029_1179708036 -2 Left 1179708029 21:43193813-43193835 CCTGGCGAGGCCCCTCCTGGTTC No data
Right 1179708036 21:43193834-43193856 TCCCACAGGGTCCTCAGAGCAGG No data
1179708029_1179708038 -1 Left 1179708029 21:43193813-43193835 CCTGGCGAGGCCCCTCCTGGTTC No data
Right 1179708038 21:43193835-43193857 CCCACAGGGTCCTCAGAGCAGGG No data
1179708029_1179708040 0 Left 1179708029 21:43193813-43193835 CCTGGCGAGGCCCCTCCTGGTTC No data
Right 1179708040 21:43193836-43193858 CCACAGGGTCCTCAGAGCAGGGG No data
1179708029_1179708041 4 Left 1179708029 21:43193813-43193835 CCTGGCGAGGCCCCTCCTGGTTC No data
Right 1179708041 21:43193840-43193862 AGGGTCCTCAGAGCAGGGGCTGG No data
1179708029_1179708043 30 Left 1179708029 21:43193813-43193835 CCTGGCGAGGCCCCTCCTGGTTC No data
Right 1179708043 21:43193866-43193888 TGCTGTCCCTTCCTCACCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179708029 Original CRISPR GAACCAGGAGGGGCCTCGCC AGG (reversed) Intergenic
No off target data available for this crispr