ID: 1179708036

View in Genome Browser
Species Human (GRCh38)
Location 21:43193834-43193856
Sequence TCCCACAGGGTCCTCAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179708022_1179708036 22 Left 1179708022 21:43193789-43193811 CCACAGCCGGGACGGGGGCTTGG No data
Right 1179708036 21:43193834-43193856 TCCCACAGGGTCCTCAGAGCAGG No data
1179708025_1179708036 16 Left 1179708025 21:43193795-43193817 CCGGGACGGGGGCTTGGGCCTGG No data
Right 1179708036 21:43193834-43193856 TCCCACAGGGTCCTCAGAGCAGG No data
1179708021_1179708036 23 Left 1179708021 21:43193788-43193810 CCCACAGCCGGGACGGGGGCTTG No data
Right 1179708036 21:43193834-43193856 TCCCACAGGGTCCTCAGAGCAGG No data
1179708029_1179708036 -2 Left 1179708029 21:43193813-43193835 CCTGGCGAGGCCCCTCCTGGTTC No data
Right 1179708036 21:43193834-43193856 TCCCACAGGGTCCTCAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179708036 Original CRISPR TCCCACAGGGTCCTCAGAGC AGG Intergenic
No off target data available for this crispr