ID: 1179708041

View in Genome Browser
Species Human (GRCh38)
Location 21:43193840-43193862
Sequence AGGGTCCTCAGAGCAGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179708022_1179708041 28 Left 1179708022 21:43193789-43193811 CCACAGCCGGGACGGGGGCTTGG No data
Right 1179708041 21:43193840-43193862 AGGGTCCTCAGAGCAGGGGCTGG No data
1179708025_1179708041 22 Left 1179708025 21:43193795-43193817 CCGGGACGGGGGCTTGGGCCTGG No data
Right 1179708041 21:43193840-43193862 AGGGTCCTCAGAGCAGGGGCTGG No data
1179708032_1179708041 -6 Left 1179708032 21:43193823-43193845 CCCCTCCTGGTTCCCACAGGGTC No data
Right 1179708041 21:43193840-43193862 AGGGTCCTCAGAGCAGGGGCTGG No data
1179708033_1179708041 -7 Left 1179708033 21:43193824-43193846 CCCTCCTGGTTCCCACAGGGTCC No data
Right 1179708041 21:43193840-43193862 AGGGTCCTCAGAGCAGGGGCTGG No data
1179708029_1179708041 4 Left 1179708029 21:43193813-43193835 CCTGGCGAGGCCCCTCCTGGTTC No data
Right 1179708041 21:43193840-43193862 AGGGTCCTCAGAGCAGGGGCTGG No data
1179708021_1179708041 29 Left 1179708021 21:43193788-43193810 CCCACAGCCGGGACGGGGGCTTG No data
Right 1179708041 21:43193840-43193862 AGGGTCCTCAGAGCAGGGGCTGG No data
1179708034_1179708041 -8 Left 1179708034 21:43193825-43193847 CCTCCTGGTTCCCACAGGGTCCT No data
Right 1179708041 21:43193840-43193862 AGGGTCCTCAGAGCAGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179708041 Original CRISPR AGGGTCCTCAGAGCAGGGGC TGG Intergenic
No off target data available for this crispr