ID: 1179708043

View in Genome Browser
Species Human (GRCh38)
Location 21:43193866-43193888
Sequence TGCTGTCCCTTCCTCACCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179708029_1179708043 30 Left 1179708029 21:43193813-43193835 CCTGGCGAGGCCCCTCCTGGTTC No data
Right 1179708043 21:43193866-43193888 TGCTGTCCCTTCCTCACCTTAGG No data
1179708035_1179708043 15 Left 1179708035 21:43193828-43193850 CCTGGTTCCCACAGGGTCCTCAG No data
Right 1179708043 21:43193866-43193888 TGCTGTCCCTTCCTCACCTTAGG No data
1179708042_1179708043 -2 Left 1179708042 21:43193845-43193867 CCTCAGAGCAGGGGCTGGCTCTG No data
Right 1179708043 21:43193866-43193888 TGCTGTCCCTTCCTCACCTTAGG No data
1179708034_1179708043 18 Left 1179708034 21:43193825-43193847 CCTCCTGGTTCCCACAGGGTCCT No data
Right 1179708043 21:43193866-43193888 TGCTGTCCCTTCCTCACCTTAGG No data
1179708032_1179708043 20 Left 1179708032 21:43193823-43193845 CCCCTCCTGGTTCCCACAGGGTC No data
Right 1179708043 21:43193866-43193888 TGCTGTCCCTTCCTCACCTTAGG No data
1179708039_1179708043 7 Left 1179708039 21:43193836-43193858 CCACAGGGTCCTCAGAGCAGGGG No data
Right 1179708043 21:43193866-43193888 TGCTGTCCCTTCCTCACCTTAGG No data
1179708037_1179708043 8 Left 1179708037 21:43193835-43193857 CCCACAGGGTCCTCAGAGCAGGG No data
Right 1179708043 21:43193866-43193888 TGCTGTCCCTTCCTCACCTTAGG No data
1179708033_1179708043 19 Left 1179708033 21:43193824-43193846 CCCTCCTGGTTCCCACAGGGTCC No data
Right 1179708043 21:43193866-43193888 TGCTGTCCCTTCCTCACCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179708043 Original CRISPR TGCTGTCCCTTCCTCACCTT AGG Intergenic
No off target data available for this crispr