ID: 1179708436

View in Genome Browser
Species Human (GRCh38)
Location 21:43195626-43195648
Sequence GAGCAGCGCTTCAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179708428_1179708436 8 Left 1179708428 21:43195595-43195617 CCGGGGGAGGCGGGTGTCTGGAC No data
Right 1179708436 21:43195626-43195648 GAGCAGCGCTTCAGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179708436 Original CRISPR GAGCAGCGCTTCAGGGAGGA GGG Intergenic
No off target data available for this crispr