ID: 1179710342

View in Genome Browser
Species Human (GRCh38)
Location 21:43209696-43209718
Sequence GTACGGGGCCAATCCCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179710342_1179710354 16 Left 1179710342 21:43209696-43209718 CCTGGCAGGGATTGGCCCCGTAC No data
Right 1179710354 21:43209735-43209757 CTTGGCTACACAGGGCTGCTGGG No data
1179710342_1179710355 17 Left 1179710342 21:43209696-43209718 CCTGGCAGGGATTGGCCCCGTAC No data
Right 1179710355 21:43209736-43209758 TTGGCTACACAGGGCTGCTGGGG No data
1179710342_1179710350 7 Left 1179710342 21:43209696-43209718 CCTGGCAGGGATTGGCCCCGTAC No data
Right 1179710350 21:43209726-43209748 GGCAGCCTGCTTGGCTACACAGG No data
1179710342_1179710356 18 Left 1179710342 21:43209696-43209718 CCTGGCAGGGATTGGCCCCGTAC No data
Right 1179710356 21:43209737-43209759 TGGCTACACAGGGCTGCTGGGGG No data
1179710342_1179710351 8 Left 1179710342 21:43209696-43209718 CCTGGCAGGGATTGGCCCCGTAC No data
Right 1179710351 21:43209727-43209749 GCAGCCTGCTTGGCTACACAGGG No data
1179710342_1179710353 15 Left 1179710342 21:43209696-43209718 CCTGGCAGGGATTGGCCCCGTAC No data
Right 1179710353 21:43209734-43209756 GCTTGGCTACACAGGGCTGCTGG No data
1179710342_1179710348 -2 Left 1179710342 21:43209696-43209718 CCTGGCAGGGATTGGCCCCGTAC No data
Right 1179710348 21:43209717-43209739 ACCTGTGGTGGCAGCCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179710342 Original CRISPR GTACGGGGCCAATCCCTGCC AGG (reversed) Intergenic