ID: 1179710347

View in Genome Browser
Species Human (GRCh38)
Location 21:43209713-43209735
Sequence GCAGGCTGCCACCACAGGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179710347_1179710356 1 Left 1179710347 21:43209713-43209735 CCGTACCTGTGGTGGCAGCCTGC No data
Right 1179710356 21:43209737-43209759 TGGCTACACAGGGCTGCTGGGGG No data
1179710347_1179710354 -1 Left 1179710347 21:43209713-43209735 CCGTACCTGTGGTGGCAGCCTGC No data
Right 1179710354 21:43209735-43209757 CTTGGCTACACAGGGCTGCTGGG No data
1179710347_1179710353 -2 Left 1179710347 21:43209713-43209735 CCGTACCTGTGGTGGCAGCCTGC No data
Right 1179710353 21:43209734-43209756 GCTTGGCTACACAGGGCTGCTGG No data
1179710347_1179710355 0 Left 1179710347 21:43209713-43209735 CCGTACCTGTGGTGGCAGCCTGC No data
Right 1179710355 21:43209736-43209758 TTGGCTACACAGGGCTGCTGGGG No data
1179710347_1179710350 -10 Left 1179710347 21:43209713-43209735 CCGTACCTGTGGTGGCAGCCTGC No data
Right 1179710350 21:43209726-43209748 GGCAGCCTGCTTGGCTACACAGG No data
1179710347_1179710351 -9 Left 1179710347 21:43209713-43209735 CCGTACCTGTGGTGGCAGCCTGC No data
Right 1179710351 21:43209727-43209749 GCAGCCTGCTTGGCTACACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179710347 Original CRISPR GCAGGCTGCCACCACAGGTA CGG (reversed) Intergenic
No off target data available for this crispr