ID: 1179710351

View in Genome Browser
Species Human (GRCh38)
Location 21:43209727-43209749
Sequence GCAGCCTGCTTGGCTACACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179710346_1179710351 -8 Left 1179710346 21:43209712-43209734 CCCGTACCTGTGGTGGCAGCCTG No data
Right 1179710351 21:43209727-43209749 GCAGCCTGCTTGGCTACACAGGG No data
1179710347_1179710351 -9 Left 1179710347 21:43209713-43209735 CCGTACCTGTGGTGGCAGCCTGC No data
Right 1179710351 21:43209727-43209749 GCAGCCTGCTTGGCTACACAGGG No data
1179710345_1179710351 -7 Left 1179710345 21:43209711-43209733 CCCCGTACCTGTGGTGGCAGCCT No data
Right 1179710351 21:43209727-43209749 GCAGCCTGCTTGGCTACACAGGG No data
1179710342_1179710351 8 Left 1179710342 21:43209696-43209718 CCTGGCAGGGATTGGCCCCGTAC No data
Right 1179710351 21:43209727-43209749 GCAGCCTGCTTGGCTACACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179710351 Original CRISPR GCAGCCTGCTTGGCTACACA GGG Intergenic
No off target data available for this crispr