ID: 1179710354

View in Genome Browser
Species Human (GRCh38)
Location 21:43209735-43209757
Sequence CTTGGCTACACAGGGCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179710349_1179710354 -6 Left 1179710349 21:43209718-43209740 CCTGTGGTGGCAGCCTGCTTGGC No data
Right 1179710354 21:43209735-43209757 CTTGGCTACACAGGGCTGCTGGG No data
1179710347_1179710354 -1 Left 1179710347 21:43209713-43209735 CCGTACCTGTGGTGGCAGCCTGC No data
Right 1179710354 21:43209735-43209757 CTTGGCTACACAGGGCTGCTGGG No data
1179710342_1179710354 16 Left 1179710342 21:43209696-43209718 CCTGGCAGGGATTGGCCCCGTAC No data
Right 1179710354 21:43209735-43209757 CTTGGCTACACAGGGCTGCTGGG No data
1179710346_1179710354 0 Left 1179710346 21:43209712-43209734 CCCGTACCTGTGGTGGCAGCCTG No data
Right 1179710354 21:43209735-43209757 CTTGGCTACACAGGGCTGCTGGG No data
1179710345_1179710354 1 Left 1179710345 21:43209711-43209733 CCCCGTACCTGTGGTGGCAGCCT No data
Right 1179710354 21:43209735-43209757 CTTGGCTACACAGGGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179710354 Original CRISPR CTTGGCTACACAGGGCTGCT GGG Intergenic
No off target data available for this crispr